ID: 964724944

View in Genome Browser
Species Human (GRCh38)
Location 3:159804997-159805019
Sequence AGAAATCTGCTGAGGATGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 3, 3: 25, 4: 238}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964724944_964724949 3 Left 964724944 3:159804997-159805019 CCAGTCATCCTCAGCAGATTTCT 0: 1
1: 0
2: 3
3: 25
4: 238
Right 964724949 3:159805023-159805045 CAATCTCATTGGCCCAAATAGGG 0: 1
1: 0
2: 1
3: 14
4: 118
964724944_964724950 8 Left 964724944 3:159804997-159805019 CCAGTCATCCTCAGCAGATTTCT 0: 1
1: 0
2: 3
3: 25
4: 238
Right 964724950 3:159805028-159805050 TCATTGGCCCAAATAGGGTGTGG 0: 1
1: 0
2: 0
3: 10
4: 90
964724944_964724948 2 Left 964724944 3:159804997-159805019 CCAGTCATCCTCAGCAGATTTCT 0: 1
1: 0
2: 3
3: 25
4: 238
Right 964724948 3:159805022-159805044 TCAATCTCATTGGCCCAAATAGG 0: 1
1: 1
2: 2
3: 28
4: 186
964724944_964724946 -8 Left 964724944 3:159804997-159805019 CCAGTCATCCTCAGCAGATTTCT 0: 1
1: 0
2: 3
3: 25
4: 238
Right 964724946 3:159805012-159805034 AGATTTCTCCTCAATCTCATTGG 0: 1
1: 0
2: 1
3: 30
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964724944 Original CRISPR AGAAATCTGCTGAGGATGAC TGG (reversed) Intronic
900778637 1:4602646-4602668 AGAACTCTCCTGAGGACGAATGG + Intergenic
901449965 1:9329940-9329962 AGAAAATTGCTGTGGATGACAGG + Intronic
904220839 1:28967573-28967595 AGAAAACTGCTGAAAATGAAGGG - Intronic
907039285 1:51243868-51243890 AGCAAACTGCTCAGTATGACTGG - Intronic
907597345 1:55732128-55732150 AGTTATCTGCAGAAGATGACAGG - Intergenic
909501104 1:76336868-76336890 AGAAATCTCTTTAGGATGGCAGG - Intronic
910084487 1:83383248-83383270 AGCAATTCACTGAGGATGACAGG - Intergenic
910681443 1:89869737-89869759 AGAGATCTGCTGAGTCTGATGGG - Intronic
911469394 1:98298384-98298406 AGAATTCTGCTGAGGTTTAGAGG + Intergenic
913263654 1:117023829-117023851 AGAAAGATGCTGAGAATGACTGG + Intronic
914334304 1:146700918-146700940 ACAAAACTGGTGAGGAAGACAGG - Intergenic
914684123 1:149962980-149963002 AGGAATCTTCTGGGGAAGACTGG + Intronic
916288815 1:163140859-163140881 AGAAAAATGCTGTTGATGACGGG - Intronic
917064486 1:171076743-171076765 AGTCATCTGCTGAGAATGAGTGG - Intergenic
921801405 1:219407129-219407151 AGAAATCTGCTAAGCATTTCTGG - Intergenic
922147058 1:222957092-222957114 AGAAATCTGAAAAGGATGACAGG - Intronic
922446359 1:225701173-225701195 AGAAATCTGCTGAGGATTCAGGG - Intergenic
922781048 1:228252583-228252605 AGTTATCTGCAGAAGATGACAGG + Intronic
923032718 1:230262832-230262854 GAAAATCTGCTGAGGAGAACAGG - Intronic
923540704 1:234886186-234886208 AGGAAGCTGGTGAGGATGGCTGG - Intergenic
1063446475 10:6121101-6121123 AGACATCTGCTTAGGAAGAGAGG - Intergenic
1063823119 10:9860709-9860731 AAAGATCTGCACAGGATGACTGG - Intergenic
1065711753 10:28525003-28525025 GGAAATCTCCTGAGGAAGAAAGG - Intergenic
1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG + Intergenic
1067030881 10:42878360-42878382 AGGAATCTGCTCAGGATCCCGGG - Intergenic
1070570136 10:77635038-77635060 AGAAATCTGCCAGGGATGAGAGG - Intronic
1073587803 10:104727448-104727470 GGAAATATGCAGATGATGACTGG - Intronic
1077812256 11:5649948-5649970 AGACAGCTGCTCAGGATGATGGG + Intergenic
1080436194 11:32247215-32247237 AAAAATCTGCTGGGGATTTCAGG + Intergenic
1085868295 11:80320825-80320847 AGATATCTGCTAATGATGAGAGG + Intergenic
1086040840 11:82476605-82476627 AGAAATCTGCTGGGGAGAAGCGG - Intergenic
1089927325 11:122272209-122272231 TGAAATATAATGAGGATGACTGG + Intergenic
1091089326 11:132754931-132754953 AGAAATCTGCTGAAGAAGTGGGG + Intronic
1092274208 12:7046966-7046988 AGGAATGTGCTGAGGATGGCAGG + Intronic
1094363803 12:29659141-29659163 AGAATTGTGCAGAGGTTGACTGG - Intronic
1094364931 12:29670353-29670375 AGGAATGTGCTAAGGATTACAGG - Intronic
1094679180 12:32652411-32652433 ATAAATATGCTGAGGATAATGGG + Intergenic
1097183668 12:57185005-57185027 AGAGATCAGCTGAGGAGGCCAGG - Intronic
1097714123 12:62947474-62947496 AGAAAGATGGGGAGGATGACTGG - Intergenic
1098749845 12:74279564-74279586 AGTTATCTGCAGAAGATGACAGG - Intergenic
1099375646 12:81893930-81893952 AGTAATCTGCAGAAGATGGCAGG - Intergenic
1101126395 12:101639613-101639635 TGAAAACTGGTGAGGATGATTGG + Intronic
1101264129 12:103066095-103066117 AGTTATCTGCAGAAGATGACAGG - Intergenic
1101931324 12:109016482-109016504 GGGAAACTGCTGAGGATAACAGG - Intronic
1102187556 12:110961046-110961068 AGAAACCTGCTGGGGATTTCTGG - Intergenic
1102438731 12:112945613-112945635 AGAGACCTGCTTATGATGACTGG - Intronic
1107285062 13:38781408-38781430 TAAAATATGCTGAGGGTGACAGG - Intronic
1107697044 13:43010678-43010700 AGAAATGTGATGAGGAATACAGG + Intergenic
1107736144 13:43400283-43400305 AGGCATCTGCTGAGGATAAGTGG - Intronic
1107983578 13:45755999-45756021 AGTTATCTGCAGAAGATGACAGG + Intergenic
1108094927 13:46891679-46891701 ACCAAGCTGCTGAGGTTGACAGG + Intronic
1108164021 13:47673380-47673402 AGAAGTCTCCTGAGGCTGAGTGG + Intergenic
1108270765 13:48757210-48757232 AGAAGTCAGCTGAGGAGGGCTGG - Intergenic
1109314181 13:60730626-60730648 ATAAATCAGCAGAGCATGACAGG + Intergenic
1109914047 13:68956168-68956190 AGTAATCTGCTGATGTTGGCTGG + Intergenic
1110412163 13:75216174-75216196 AGAAGTCTGCTGAGGATTCCAGG - Intergenic
1112700597 13:102003398-102003420 ATAAATTTGATGAGGCTGACTGG + Intronic
1113252037 13:108464061-108464083 AGAAATCTTCAGAGGAGGAAGGG + Intergenic
1115059714 14:29173867-29173889 AGTTATCTGCAGAAGATGACAGG - Intergenic
1116795236 14:49383170-49383192 AGAAATCTGCTGAAGTGGTCAGG + Intergenic
1117640813 14:57797622-57797644 ATAAATCTACTGAGGAAGAAGGG + Intronic
1117885478 14:60357023-60357045 GCAAATCTGCTCAGGATGGCGGG - Intergenic
1118321069 14:64753701-64753723 AGAAATCCACTGGGGATGAGAGG - Exonic
1118505558 14:66407322-66407344 AGAAGTCTACTGAGGATTTCTGG + Intergenic
1120183134 14:81366296-81366318 AGAACTCTGCCGCAGATGACAGG + Intronic
1120252202 14:82071496-82071518 ACAGATCTGCAGAGAATGACAGG - Intergenic
1120343578 14:83254447-83254469 AGATATTTGCTGAGGATTAGAGG + Intergenic
1122004729 14:98692706-98692728 AGAAAGCTGATGAGGATGAGTGG + Intergenic
1122637540 14:103137488-103137510 AGAAAGCTGCTAAGGCTGCCTGG - Intergenic
1125122189 15:36174685-36174707 AGAAATATTGTGAGGATGAAAGG - Intergenic
1125378471 15:39060151-39060173 AGAAAGCTCCTAAGGATGAGGGG + Intergenic
1128698790 15:69788886-69788908 ACAAAGAAGCTGAGGATGACAGG - Intergenic
1129511783 15:76129344-76129366 AGAAAACTGCTAAGGAGGCCAGG + Intronic
1129710331 15:77817493-77817515 AGAGCTGTGCAGAGGATGACAGG + Intronic
1131009370 15:89004426-89004448 AGAAATCAGCAAAGGATCACAGG - Intergenic
1137022417 16:35441840-35441862 ACAAATCTACTGAGGGTGGCAGG + Intergenic
1139802779 16:69537483-69537505 AGATCTCTGGTGAGGAAGACAGG + Intergenic
1139999312 16:71010314-71010336 ACAAAGCTGGTGAGGAAGACAGG + Intronic
1141069046 16:80936691-80936713 AGAACTATGCTGTGGATTACTGG + Intergenic
1142123272 16:88397426-88397448 AGAAGACTGCTGAGGAAGGCTGG + Intergenic
1142970393 17:3607369-3607391 ACATATCTCCTGTGGATGACAGG - Intergenic
1143322762 17:6078885-6078907 ACAAATCTGATGAGGTTGTCTGG + Intronic
1143922617 17:10342793-10342815 AGAAATCTGCTCATGGGGACAGG + Intronic
1145289550 17:21532421-21532443 AGACATATCCTGTGGATGACTGG - Exonic
1149298834 17:55285622-55285644 AGAAATCTGCTTGGGCTGCCTGG + Intronic
1149368984 17:55974198-55974220 AGAATTGTGCTGAGGAAGAGGGG + Intergenic
1152946848 17:83202663-83202685 AGAACTCTGCAGAGGATGCTGGG - Intergenic
1155205240 18:23552797-23552819 AGATTTCTGCTGTGGATGAAGGG - Intronic
1157557167 18:48620448-48620470 AAAAATCTGCTGAGGATTTGTGG - Intronic
1158248560 18:55460383-55460405 AAAAACATGCTGAGGATGCCAGG + Intronic
1159313982 18:66747136-66747158 TGAAATCAGCTGAGGAATACAGG - Intergenic
1159546217 18:69842030-69842052 AAACATGTGCTGAGGGTGACAGG + Exonic
1159644164 18:70897925-70897947 GATAATCTGCTGAGGATGAAGGG - Intergenic
1164575732 19:29404394-29404416 AGAAATGTGCTGGTGATGAGAGG + Intergenic
1167406358 19:49311138-49311160 AGAAATTTGCTTGGGCTGACTGG + Exonic
925572966 2:5331220-5331242 AGAAATCCTGTGAGGAAGACAGG - Intergenic
927778737 2:25922626-25922648 AGAAATCTGCTAGGGATTTCTGG - Intergenic
928419362 2:31125538-31125560 ACAAATATGCTCAGTATGACTGG + Intronic
930258016 2:49113894-49113916 TGAAGTCTCTTGAGGATGACAGG - Intronic
931055121 2:58461042-58461064 AGAAACCTGCTGAGGCTGACAGG - Intergenic
931990534 2:67785494-67785516 AGCCATGTGCTGAGGATGAAGGG + Intergenic
932176151 2:69604676-69604698 AAAAACATGCTGAGGATGACTGG + Intronic
932869554 2:75384234-75384256 AGAATTTTGCTGAGGATTAGGGG + Intergenic
933265687 2:80178412-80178434 AGTTATCTGCAGAAGATGACAGG + Intronic
933276428 2:80289129-80289151 AGATATATGCTGCGGATGAGAGG + Intronic
936004282 2:108868632-108868654 AGAAATCTGCTGAGAGTTTCTGG + Intronic
936563469 2:113562532-113562554 AGATCTCTGCTTAGCATGACTGG + Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
938065043 2:128277314-128277336 AGAGATCTGCTATGGATGTCAGG - Intronic
938133072 2:128733714-128733736 AGACATCCACTGAGGATGGCAGG - Intergenic
938178946 2:129162558-129162580 AGATAGCTGCTGAGGACTACAGG + Intergenic
942229528 2:173847356-173847378 AGACACCAGCTGAGGATGGCTGG + Intergenic
942251084 2:174048415-174048437 TGACATCTGCTGGGGATGTCAGG + Intergenic
942427705 2:175877132-175877154 AGGAAGGTGCTCAGGATGACAGG + Intergenic
944609794 2:201390896-201390918 GGGACTCAGCTGAGGATGACTGG + Intronic
946256666 2:218447258-218447280 AGACTTCTCCTGAGGGTGACAGG + Intronic
946474077 2:219991134-219991156 AGAAGTCTGCTGAGGATGTCTGG + Intergenic
946723661 2:222639432-222639454 AAAAATCTGCAGAGGAAGAAAGG + Intronic
948978608 2:241480401-241480423 AGAGCTCTGCTGGGGAGGACAGG - Intronic
1169548937 20:6681407-6681429 AGAAGTATGCTGAGGCAGACTGG - Intergenic
1170092312 20:12604140-12604162 AGGTATCTGCAGAGGATGACAGG + Intergenic
1170159200 20:13295451-13295473 AAAAATCTGCTGGGGATGTCTGG - Intronic
1172039426 20:32033435-32033457 AAAAATCTGATGAAGATGTCGGG - Intergenic
1172809161 20:37634632-37634654 TGAGATCTGCTGAGGCTGACGGG - Intergenic
1172980598 20:38938695-38938717 CGACATGGGCTGAGGATGACAGG - Intronic
1173020557 20:39264478-39264500 AGAAGTCTGCTGAGCAGGAGGGG + Intergenic
1174128420 20:48325563-48325585 GGAAAGTTGCAGAGGATGACGGG - Intergenic
1174666841 20:52266000-52266022 AGAAATGGAGTGAGGATGACAGG - Intergenic
1174753612 20:53136801-53136823 AAAAATCTACTGAGGAAGAAGGG + Intronic
1176056115 20:63150246-63150268 AGAAATCTGCTGCCGTTGGCTGG - Intergenic
1177418875 21:20829414-20829436 AGAAAGATGCTGAGGATAATAGG + Intergenic
1178106263 21:29322632-29322654 AGAAATCATTTGAGTATGACAGG + Intronic
1178470483 21:32887901-32887923 AGCAATCATCTGAGGCTGACAGG - Intergenic
1179873602 21:44256278-44256300 ACACACCTGCTGAGGCTGACTGG + Intronic
1182784370 22:32894502-32894524 AGAAATCTGCTAAGGACTTCTGG + Intronic
1183044957 22:35212103-35212125 AGAAAGCTGCTGAGGCTGGCTGG - Intergenic
1183694935 22:39416237-39416259 TGAGATCTGCTGAGAATCACTGG - Intronic
952509625 3:34039902-34039924 AAAAATCAGCTGAGCATGATGGG + Intergenic
953830931 3:46297156-46297178 AGAAGTCTGCTGAGGATTCCTGG - Intergenic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
955603526 3:60673813-60673835 AAAAAGCTGCTGAGGATGGGAGG - Intronic
956090826 3:65665136-65665158 GGAAATTTGCTGAGTGTGACAGG - Intronic
956271546 3:67453069-67453091 AGAAATATGCTGAAGATGTTGGG - Intronic
956360449 3:68441408-68441430 AGTAATCTGCAGAAGATGGCAGG - Intronic
956703897 3:71982917-71982939 AGTTATCTGCAGAAGATGACAGG + Intergenic
956780826 3:72601806-72601828 AGAAAAAAGTTGAGGATGACAGG + Intergenic
957051426 3:75415186-75415208 AGAAGGCAGCTGAGGATGGCAGG - Intergenic
962269789 3:133969134-133969156 AGAAATATGCTGAGCAGGTCAGG + Intronic
962717339 3:138138044-138138066 AGGAACCTTCTGAGGATGAAGGG - Intergenic
964724944 3:159804997-159805019 AGAAATCTGCTGAGGATGACTGG - Intronic
964772243 3:160236520-160236542 AGGAGACTGCTGGGGATGACTGG - Intronic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG + Intronic
967144790 3:186597490-186597512 AGGGATCTGCTGCGGAGGACAGG - Intergenic
967732748 3:192920923-192920945 AGAAATCTGATCTGGCTGACGGG - Intergenic
968223731 3:196958992-196959014 AGGCATCTGCTGAGGGTGAGTGG + Intronic
969511487 4:7620516-7620538 AGGAATCTGCTTCGGTTGACAGG - Intronic
971857654 4:32062863-32062885 AGTTATCTGCAGAAGATGACAGG + Intergenic
971985951 4:33824183-33824205 AGAAATATGCTGAAGCTGGCAGG + Intergenic
972067482 4:34967869-34967891 AGAAATCTGCTTAGAGTGATGGG + Intergenic
972381335 4:38523044-38523066 TGAACTCTGGTGAGGATGAAAGG - Intergenic
972771644 4:42202964-42202986 GGAAATCTGCAGAGGATGGATGG + Intergenic
974166349 4:58209113-58209135 ATAAATTTGATGAGGATGAGAGG + Intergenic
974688523 4:65265560-65265582 AGTAATCTGCTGAGGATGGTGGG - Intergenic
975133718 4:70853361-70853383 AGAAATAAGCTGAGGAGGCCGGG - Intergenic
975455946 4:74589811-74589833 AGAACTCTGCTGTTGATGAGTGG - Intergenic
975620741 4:76293794-76293816 AGAAATGTGGTGAGGATTAAAGG + Intronic
975966646 4:79981096-79981118 AGAAATCTGGAGTGGATGATGGG - Intronic
976104880 4:81605974-81605996 AGAGATCTGGAGAGGATGGCTGG - Intronic
977204714 4:94155654-94155676 AGTTATCTGCAGAAGATGACAGG - Intergenic
977847096 4:101779251-101779273 AGCAATCTGCAGATGATGTCAGG + Intronic
978691093 4:111511582-111511604 TGTCATCTTCTGAGGATGACAGG + Intergenic
980229862 4:130035090-130035112 AGAAATATTCTTAAGATGACTGG - Intergenic
982094451 4:151909174-151909196 AGCAAGCTGCTGGGGATGGCTGG + Intergenic
982159684 4:152555148-152555170 AGAAAGCAGCTGAAGAGGACGGG - Intergenic
982280385 4:153678164-153678186 ACACATCTGCTAAGTATGACTGG - Intergenic
982646047 4:158026544-158026566 AGAATTCTGGTGAGGTTGGCTGG - Intergenic
984931386 4:184850459-184850481 AGAAATCTGCTGGGGATGCCTGG + Intergenic
985078828 4:186244498-186244520 AGTAAGTTGCTGAGGCTGACGGG + Intronic
985575799 5:673033-673055 AGAAAGCTGCTGACTCTGACAGG - Intronic
987695491 5:21324410-21324432 AGAAGTCTGTTGAGTATGCCTGG + Intergenic
988316379 5:29634977-29634999 AGACTTCAGCTGAGGAAGACTGG - Intergenic
988532110 5:32036975-32036997 AGACGTGTGCTGAGGAGGACTGG + Intronic
990075014 5:51833286-51833308 AGAGTTCTGCTCATGATGACAGG - Intergenic
992109883 5:73482906-73482928 AGTTATCTGCAGAAGATGACAGG + Intergenic
992364737 5:76080394-76080416 AGACATCTGCTGTGGAAGCCAGG + Intergenic
996981609 5:129502493-129502515 AGAAATCATCTGAGCATTACAGG - Intronic
997992532 5:138557411-138557433 AGAAATATGCTGAAGAAGACCGG - Exonic
998136339 5:139676394-139676416 AGGAATCTGCGGAGGAGGCCTGG - Intronic
1000417906 5:161003655-161003677 AGAAATCTGCTTAGTCTGATGGG + Intergenic
1004467902 6:15902813-15902835 AGAAAGATGATGATGATGACAGG + Intergenic
1007201221 6:40110951-40110973 AGAACTATCCTGAGAATGACTGG - Intergenic
1007504243 6:42322790-42322812 AGAAAACTGATGAGGCTGAGAGG + Intronic
1007615412 6:43176810-43176832 GGAAGTCAGGTGAGGATGACTGG + Intronic
1008131443 6:47724374-47724396 AGAAATGTGGAGAGGATGACAGG + Intergenic
1008244121 6:49149995-49150017 AGAAATGGGCAGAGGATGAGAGG - Intergenic
1008547106 6:52592817-52592839 AGAAATCTGCTGAGGCTTGCAGG + Intergenic
1009318793 6:62258458-62258480 AGAAAATGGCTGAGGATCACGGG + Intronic
1009390114 6:63135106-63135128 AGTTATCTGCAGAAGATGACAGG + Intergenic
1011161898 6:84400676-84400698 TGAAATCTGGTGAGGATAAGGGG - Intergenic
1011512495 6:88116325-88116347 AGAAATCTGGTTAGCATCACTGG - Intergenic
1012650437 6:101745380-101745402 AGAAAACAGCTGAGCATGATGGG + Intronic
1013136877 6:107290780-107290802 AGAATGCTGATGAGGATGACAGG - Intronic
1014300177 6:119671946-119671968 AGAAATCTCATGAGCATTACAGG - Intergenic
1017846407 6:158262233-158262255 AGAAACCTGCGGAGGCTGAGTGG - Intronic
1017861244 6:158399307-158399329 AGAACTCAGCTGAGGATGAATGG - Intronic
1018781623 6:167072875-167072897 AGAAATCTGCTGTTAATGATGGG + Intergenic
1019088089 6:169500795-169500817 GGAAATCTGCTGACTTTGACTGG + Intronic
1020318488 7:6923931-6923953 AGAAAGCAGCTGAGGATGGGAGG - Intergenic
1023832152 7:44045560-44045582 AGAAATATGCTGAGTATGGTGGG + Intronic
1027301306 7:76839367-76839389 AGCAATTCACTGAGGATGACAGG - Intergenic
1028146253 7:87323185-87323207 AGAACTTTGCTGAGCATGTCTGG + Intergenic
1028963147 7:96772146-96772168 AGGAATCTGTTGAGGTTGAAGGG - Intergenic
1029442622 7:100595472-100595494 AGAGATCAGCTGGGGATGGCAGG + Intronic
1031236824 7:119187986-119188008 AGTTATCTGCAGAAGATGACAGG - Intergenic
1033321968 7:140347887-140347909 ACATATCTGCTGAGGATAAAGGG - Intronic
1035280375 7:157774770-157774792 AGAAATCTGCCCAAGATGAGGGG + Intronic
1037176942 8:15958457-15958479 AGAAATATCTTGAGGATGACAGG - Intergenic
1037659039 8:20911597-20911619 AGAGGTCAGCAGAGGATGACTGG - Intergenic
1038553634 8:28490961-28490983 AGAAATCTAAAGAGGAAGACTGG + Intergenic
1039093565 8:33858198-33858220 AGCAACCAGCCGAGGATGACAGG + Intergenic
1041491973 8:58443148-58443170 AGAAATTTGCTGAGAGTGAGGGG - Intronic
1041934551 8:63321300-63321322 AGTTATCTGCAGAAGATGACAGG - Intergenic
1042358085 8:67851723-67851745 AGAAATTGCCTGGGGATGACTGG - Intergenic
1042520859 8:69709980-69710002 AGGACTCTGGTGAGGATTACAGG - Intronic
1043259973 8:78184223-78184245 AGCTATCTGCAGAAGATGACAGG + Intergenic
1044208397 8:89519664-89519686 AGACATTTGCTGAGGATATCTGG + Intergenic
1044688278 8:94850221-94850243 AGAAATCTGATACGGAAGACAGG - Intronic
1045613926 8:103883888-103883910 AGAAAGCTGCTGTGAATGTCAGG - Intronic
1046540747 8:115579113-115579135 AGAGTTCTGGTGAGGATGAAAGG + Intronic
1046911316 8:119630783-119630805 TGAATTCAGCTGAGAATGACAGG + Intronic
1047942807 8:129842361-129842383 AGAAAGGGGGTGAGGATGACAGG - Intronic
1049889260 9:53193-53215 AGATCTCTGCTTAGCATGACTGG - Intergenic
1050002725 9:1095748-1095770 AGAAAACTGCTGAGAATATCTGG - Intergenic
1050961580 9:11739959-11739981 AGAAAACTGATGAGCATGACAGG - Intergenic
1051028458 9:12644637-12644659 AGAACTGTGCTCAGGATGGCAGG - Intergenic
1051045430 9:12867418-12867440 AGAATTCTGCTGTGAATGTCTGG + Intergenic
1051730832 9:20141012-20141034 AGAAATCTTCTGAGGAGGAGAGG - Intergenic
1052442272 9:28512312-28512334 AGTTATCTGCAGAAGATGACAGG + Intronic
1052456861 9:28710597-28710619 AAAAATCTACTTGGGATGACTGG + Intergenic
1052847397 9:33349372-33349394 AGTAATGTGGAGAGGATGACAGG + Intronic
1053253444 9:36594889-36594911 AGAAATCTGATAGGTATGACTGG - Intronic
1053730749 9:41054478-41054500 AGATCTCTGCTTAGCATGACTGG - Intergenic
1054697750 9:68377602-68377624 AGATCTCTGCTTAGCATGACTGG + Intronic
1057092734 9:92274248-92274270 AGAAATCAGCTTAGGATGAAAGG + Intronic
1059504098 9:114782164-114782186 TCAAATCTGCAAAGGATGACTGG - Intergenic
1059535609 9:115077483-115077505 AGAAATATGATGAGGAGGCCGGG - Intronic
1060673451 9:125490984-125491006 AAAAATTAGCTGAGGATGGCGGG + Intronic
1061465321 9:130773903-130773925 AGGAAACTTCTGAGGATGATGGG - Intronic
1186803478 X:13116553-13116575 GGAAATCTGTGGAGTATGACCGG - Intergenic
1188633215 X:32394623-32394645 AGGTATCTGCTGAGGATGAGAGG + Intronic
1189549617 X:42079320-42079342 GGTACTCTGGTGAGGATGACTGG + Intergenic
1190144198 X:47875666-47875688 AGCAATCTGCTGATGAGGATGGG - Intronic
1191658808 X:63629837-63629859 AGTTATCTGCTGAAGATGGCAGG + Intergenic
1191921585 X:66262423-66262445 AGTCATCTGCTGAGAATGAAAGG + Intronic
1191941263 X:66483896-66483918 AGTTATCTGCAGAAGATGACAGG + Intergenic
1193832946 X:86310065-86310087 AGTTATCTGCAGAAGATGACAGG - Intronic
1194513420 X:94822284-94822306 AGTTATCTGCAGAAGATGACAGG + Intergenic
1195939663 X:110157592-110157614 TGACAACTGCTGAGAATGACAGG + Intronic
1196632931 X:117964490-117964512 ATAACTCTGCTGAGGATTAGGGG - Intronic
1197002284 X:121452889-121452911 AGTTATCTGCAGAAGATGACAGG - Intergenic
1197591864 X:128419355-128419377 AGTTATCTGCAGAAGATGACTGG - Intergenic
1198503803 X:137281056-137281078 AGAGGAGTGCTGAGGATGACAGG + Intergenic
1198508899 X:137329176-137329198 AGAACTCTTCTGAGGCAGACAGG - Intergenic
1199324365 X:146479260-146479282 AAAAATTTGCTGAGGATGGTGGG - Intergenic
1200340497 X:155390672-155390694 AGTTATCTGCAGAAGATGACAGG + Intergenic
1200501688 Y:3957896-3957918 AGTCATCTTCAGAGGATGACAGG + Intergenic