ID: 964729227

View in Genome Browser
Species Human (GRCh38)
Location 3:159847233-159847255
Sequence CGTTATGTATGTGCATGAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 79}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964729227_964729228 -2 Left 964729227 3:159847233-159847255 CCTATTCATGCACATACATAACG 0: 1
1: 0
2: 0
3: 7
4: 79
Right 964729228 3:159847254-159847276 CGCACAAATATATAAAATCTTGG 0: 1
1: 0
2: 0
3: 26
4: 222
964729227_964729229 -1 Left 964729227 3:159847233-159847255 CCTATTCATGCACATACATAACG 0: 1
1: 0
2: 0
3: 7
4: 79
Right 964729229 3:159847255-159847277 GCACAAATATATAAAATCTTGGG 0: 1
1: 0
2: 3
3: 39
4: 386
964729227_964729230 0 Left 964729227 3:159847233-159847255 CCTATTCATGCACATACATAACG 0: 1
1: 0
2: 0
3: 7
4: 79
Right 964729230 3:159847256-159847278 CACAAATATATAAAATCTTGGGG 0: 1
1: 0
2: 4
3: 60
4: 554

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964729227 Original CRISPR CGTTATGTATGTGCATGAAT AGG (reversed) Intronic
903512730 1:23888492-23888514 CTTTATGTCTGTGCATGTTTTGG + Intronic
905419796 1:37833516-37833538 TGTTGAGTGTGTGCATGAATAGG - Intronic
905978917 1:42204945-42204967 ATTTATGTGTGTGCATGAAGTGG + Intronic
909071767 1:71002940-71002962 CTGGATGTATGTGCATGAATTGG - Intronic
909278299 1:73717015-73717037 CGTAAAGAATGTACATGAATGGG - Intergenic
912275938 1:108258691-108258713 TGTTCTGTATGTTCATCAATAGG + Intergenic
912292291 1:108435668-108435690 TGTTCTGTATGTTCATCAATAGG - Intronic
913062850 1:115223774-115223796 CGTTAAGTAAGTGCAGGTATGGG + Intergenic
916299797 1:163261317-163261339 CTTTATGTATGAGCAGGAAGGGG - Intronic
918053596 1:180998252-180998274 GGTTATGTGTGTGCCTGCATGGG + Intronic
924734113 1:246739071-246739093 GTTTGTGTATGTGCATGAATGGG + Intronic
1065370743 10:24982655-24982677 AGGTATGTATGTGTATGGATTGG + Exonic
1067030493 10:42876446-42876468 CCTTATTTATCTGAATGAATTGG - Intergenic
1067052068 10:43027456-43027478 TGTGTTGTATGTGCATGAACAGG - Intergenic
1071707952 10:88019991-88020013 TGTTATGTATATGTGTGAATAGG - Intergenic
1071944068 10:90621263-90621285 GGTTATGTAAATGCTTGAATTGG + Intergenic
1083472435 11:62892993-62893015 CGTTATGCATGTGAAGGAAAAGG + Intergenic
1085549641 11:77356698-77356720 TGTTATGTAAATGAATGAATAGG - Intronic
1087216263 11:95498478-95498500 GGTTTTCTATGTGCATGAATAGG - Intergenic
1087237098 11:95732240-95732262 AGTTATGTATAAGGATGAATTGG - Intergenic
1093164743 12:15791505-15791527 CTTTTTGTATTTGAATGAATTGG + Intronic
1093796342 12:23316936-23316958 CATCATGAATGGGCATGAATAGG - Intergenic
1098540135 12:71645962-71645984 CTTTATGTATGTGCATGGAAGGG + Intronic
1101594570 12:106152740-106152762 ATTTATGTGTGTGCATTAATGGG - Intergenic
1101903627 12:108809582-108809604 CGTTACGTATGTGCATGTTGAGG - Intronic
1105005107 12:132716756-132716778 CTTTTAGTATGTGCATGAACAGG - Intronic
1109748043 13:66652499-66652521 AGATATCTATGTTCATGAATTGG + Intronic
1110674223 13:78220840-78220862 AGTTATGTATATGCATAAATAGG + Intergenic
1113663457 13:112123391-112123413 AGATATTTGTGTGCATGAATTGG - Intergenic
1113993533 14:16048651-16048673 CTTTGTGTTTGTGCAAGAATTGG + Intergenic
1114038097 14:18648628-18648650 CTTGATGTAGGTGCAAGAATTGG - Intergenic
1114120516 14:19666408-19666430 CTTGATGTAGGTGCAAGAATTGG + Intergenic
1118584453 14:67339598-67339620 AATTATGCATGTCCATGAATTGG - Intronic
1120176524 14:81299215-81299237 CGTTAATTCTGTGCATGTATGGG - Intronic
1127826294 15:62706791-62706813 TGTTAGATAAGTGCATGAATGGG + Intronic
1131801775 15:96076781-96076803 CTTTATGTATATGCATTTATGGG - Intergenic
1139194503 16:64903437-64903459 CATAATGCATGTGCATGAGTAGG + Intergenic
1141649022 16:85382772-85382794 TGTTGTGTGTGTGCATGCATGGG - Intergenic
1142404010 16:89876381-89876403 GGTTATGAATGTGAATGCATTGG + Intronic
1148376498 17:47151824-47151846 CTTTGTGTTTGTGCAAGAATTGG + Exonic
1153200531 18:2643161-2643183 CGAGATGTATGCACATGAATAGG - Intergenic
1155491352 18:26404926-26404948 GGTTGTGTACGTGCACGAATGGG - Intergenic
1156900832 18:42298734-42298756 TTTTATGTATGTGCATGAGCTGG - Intergenic
933191775 2:79341909-79341931 TTTTATGTATGTCCATGAAAGGG + Intronic
938538151 2:132262217-132262239 CTTTGTGTTTGTGCAAGAATTGG - Intergenic
938617283 2:133012599-133012621 GGTTATGTATGTGCCTGCACTGG + Intronic
940646941 2:156401561-156401583 CATTATGTATTTGTCTGAATAGG - Intergenic
942333727 2:174857278-174857300 CTTTAGGTCTGTGCTTGAATTGG + Intronic
942804259 2:179911223-179911245 AGTTATGTTTGTACATAAATGGG + Intergenic
943816117 2:192258018-192258040 AGCTATGTATGTGAAGGAATGGG - Intergenic
947930700 2:233962607-233962629 CATTAGGTATTTGCAGGAATTGG + Intronic
1171239407 20:23552683-23552705 AGTGATGTATGTGAAAGAATTGG - Intergenic
1171422745 20:25029548-25029570 TGTTATGAATGTTCATGTATAGG - Intronic
1171811501 20:29747208-29747230 CTTTCTGTTTGTGCAAGAATTGG - Intergenic
1171867056 20:30494002-30494024 CTTTCTGTTTGTGCAAGAATTGG - Intergenic
1171908169 20:30918531-30918553 CTTTCTGTTTGTGCAAGAATTGG + Intergenic
1180313736 22:11258862-11258884 CTTTGTGTTTGTGCAAGAATTGG - Intergenic
1180341605 22:11624693-11624715 CTTTCTGTTTGTGCAAGAATTGG + Intergenic
1180462224 22:15575669-15575691 CTTGATGTAGGTGCAAGAATTGG - Intergenic
949792320 3:7806619-7806641 CATTCTGTATGTAAATGAATTGG - Intergenic
959089126 3:101883529-101883551 TGTTAAGTAAGTGAATGAATGGG - Intergenic
964729227 3:159847233-159847255 CGTTATGTATGTGCATGAATAGG - Intronic
971581674 4:28349144-28349166 AGTTATGAATATTCATGAATGGG - Intergenic
976961220 4:90977558-90977580 CATCATATATGTGAATGAATAGG + Intronic
981920705 4:150081279-150081301 CATTATGCATGTCCATTAATAGG + Intronic
982168168 4:152634547-152634569 CATGATCTATGTGCATGACTAGG - Intronic
988050317 5:26020901-26020923 CGTTCTGTTTATGCATTAATCGG - Intergenic
988384017 5:30538190-30538212 CGTTATGTGTGATTATGAATGGG - Intergenic
999439784 5:151592287-151592309 CGTTTTGTATGTTCATGCACAGG + Intergenic
1000822522 5:166001975-166001997 TGTTATATTTGTGCAAGAATAGG - Intergenic
1003050968 6:2781143-2781165 CGCTCTGTATGTGCATGGACGGG - Intronic
1010653570 6:78483962-78483984 CTTTATGTATGTGTATGGAGAGG - Intergenic
1011721391 6:90160322-90160344 CTTTGTGTATGTGCATGTGTGGG + Intronic
1013091356 6:106903496-106903518 AGTTATGTAAATGCATGCATCGG + Intergenic
1014372585 6:120629761-120629783 TGTTCTGTGTGTGCATGAAAAGG - Intergenic
1017415520 6:154216515-154216537 GTTTTTGTATGTGCATGAATTGG + Intronic
1017506924 6:155077022-155077044 CGTTATGTATGTGAAATAAAAGG - Intronic
1018426682 6:163689223-163689245 TCTTATGAATGTGCTTGAATGGG + Intergenic
1027666832 7:81050147-81050169 AGTTATGTATGTGCTTTAGTTGG - Intergenic
1037839738 8:22235578-22235600 CCTGATGTATGTGCATTCATTGG - Intergenic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1051851530 9:21515013-21515035 CTTTATGTCTGTGTATTAATTGG - Intergenic
1059616247 9:115954520-115954542 TGTTATGTGTGTGTATGAATGGG - Intergenic
1060003013 9:119975546-119975568 CGTAATGAAGGAGCATGAATAGG + Intergenic
1203362127 Un_KI270442v1:225074-225096 CTTTCTGTTTGTGCAAGAATTGG - Intergenic
1188399681 X:29729408-29729430 CTTTATGTATTTGAAGGAATGGG + Intronic
1202087128 Y:21150009-21150031 CACTATGTATGTGCTTGAAAAGG - Intergenic