ID: 964731408

View in Genome Browser
Species Human (GRCh38)
Location 3:159870392-159870414
Sequence CTTTGTAAGTTATACCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964731408_964731412 -4 Left 964731408 3:159870392-159870414 CCTCCCAGGTATAACTTACAAAG 0: 1
1: 0
2: 0
3: 8
4: 81
Right 964731412 3:159870411-159870433 AAAGAATTTTTATCATGAATGGG 0: 1
1: 6
2: 28
3: 207
4: 1023
964731408_964731411 -5 Left 964731408 3:159870392-159870414 CCTCCCAGGTATAACTTACAAAG 0: 1
1: 0
2: 0
3: 8
4: 81
Right 964731411 3:159870410-159870432 CAAAGAATTTTTATCATGAATGG 0: 1
1: 2
2: 56
3: 336
4: 2144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964731408 Original CRISPR CTTTGTAAGTTATACCTGGG AGG (reversed) Intronic
901405466 1:9041923-9041945 CGTTGGAAGATACACCTGGGAGG + Exonic
902416785 1:16244439-16244461 CTCTGTCAGTTAAGCCTGGGGGG - Intergenic
902983470 1:20141625-20141647 CCTTGTAAGTGTTACCCGGGAGG - Intronic
909251728 1:73365879-73365901 CTTTGGAAGGTATACCTAGATGG - Intergenic
909270956 1:73623287-73623309 TTTTGTAATTTTTACCTGTGAGG - Intergenic
910906392 1:92185752-92185774 CTTTGTAACTTAGAGCTGGATGG + Intergenic
914400401 1:147314802-147314824 CATTGTAAATTATACATGGCTGG - Intergenic
919542452 1:198867031-198867053 CTTTTAAAGTTATTCCTGTGGGG + Intergenic
920915409 1:210254322-210254344 CATTGAAAGTCAAACCTGGGAGG - Intergenic
924192069 1:241564189-241564211 CTCTGTAAGCTATACATGGAAGG + Intronic
1064602653 10:17009170-17009192 ATATGTAAATTATACTTGGGAGG - Intronic
1067019778 10:42784855-42784877 CTATGTAAAACATACCTGGGGGG - Intronic
1069760285 10:70805835-70805857 CTTTGTAAGCTTTCCCTGGAGGG + Intergenic
1070558311 10:77546730-77546752 CTTTGAAAGTGAATCCTGGGTGG + Intronic
1071113613 10:82191628-82191650 CTTTGTAAGTTACATCTTGGTGG - Intronic
1074263191 10:111874580-111874602 CTTTGGAAGTTGCAGCTGGGTGG - Intergenic
1078949329 11:16111806-16111828 GTTTGTATGTTATTCCAGGGGGG + Exonic
1082291128 11:50372563-50372585 CTTTCTAATTTTTACCTGGGGGG - Intergenic
1084982665 11:72839553-72839575 CTCTGCAAGGTATACCTGGCAGG + Intronic
1090126932 11:124096164-124096186 CTTTGTAAAATATACCTCTGTGG + Intergenic
1096940134 12:55334393-55334415 CTTTGTAAGTTATAGCTGTAGGG - Intergenic
1098857780 12:75672327-75672349 GTTTGTAATTGATATCTGGGAGG + Intergenic
1106703544 13:32255899-32255921 CTCTGGAAGTTATACAAGGGAGG + Intronic
1111364719 13:87227495-87227517 CTTTGTAAGTTACACATGTGGGG - Intergenic
1112708231 13:102097107-102097129 ATTTTTTAGTTCTACCTGGGAGG - Intronic
1113244507 13:108379479-108379501 TTTAGTAAGTTCTACCTGAGAGG + Intergenic
1116122558 14:40738826-40738848 TTATCTAAGTTGTACCTGGGTGG - Intergenic
1116791148 14:49341726-49341748 CCTTTTAAGTTATAACTGGAAGG + Intergenic
1118909866 14:70052327-70052349 CTTTCTCTTTTATACCTGGGTGG + Intronic
1121620764 14:95346716-95346738 CTTTGCAAGTTCTACCTTCGTGG - Intergenic
1127454564 15:59145137-59145159 CTTTGAAAGTCATTCCTGGCCGG - Intronic
1128244863 15:66126240-66126262 CATTGTAAGTTATATGTGGAGGG - Intronic
1129336277 15:74854006-74854028 CTTTGTCAGCACTACCTGGGGGG + Exonic
1134565833 16:15251246-15251268 CATTGTAAATTTTACCTTGGTGG - Intergenic
1134736662 16:16505452-16505474 CATTGTAAATTTTACCTTGGTGG + Intergenic
1134930855 16:18206716-18206738 CATTGTAAATTTTACCTTGGTGG - Intergenic
1138053761 16:53811158-53811180 CTATGTGAGTTAGACATGGGTGG + Intronic
1138323234 16:56137540-56137562 CTTTGTAAGATAGACCAGGAAGG - Intergenic
1143527628 17:7481740-7481762 CTGGGTAAGTTGTTCCTGGGAGG - Intronic
1148321167 17:46754413-46754435 ATTTGAAAGTTATTCCTGGAGGG + Intronic
1155227746 18:23744444-23744466 CTTATTAAGTTAGGCCTGGGTGG + Intronic
1155727757 18:29110218-29110240 CTTTGTAAGTGAAACATGTGAGG - Intergenic
1157909098 18:51598269-51598291 CATTGAAAGTTATACAAGGGAGG + Intergenic
1159616502 18:70586116-70586138 CTTTGCCAGGTATTCCTGGGTGG - Intergenic
1164123289 19:22287220-22287242 TTTTGTAAATTATACATTGGGGG - Intronic
1164205665 19:23056593-23056615 CTTTGTATTTATTACCTGGGTGG - Intergenic
1166121355 19:40689551-40689573 CTTTGTGTGTGGTACCTGGGGGG - Intronic
926033202 2:9611472-9611494 CTTTGTGAGCTATACCAGGGTGG - Intronic
927796885 2:26057166-26057188 ATTTGTATGTTATGTCTGGGAGG + Intronic
930643793 2:53881931-53881953 CTTTGTAAGCTATTCTTGGTTGG + Intronic
933875276 2:86614299-86614321 CTTTATAAGTTTTACCTAGAAGG + Intronic
947965364 2:234275968-234275990 TTTTTTTAGTTATACCTGAGTGG - Intergenic
948434277 2:237942562-237942584 CTTTGGAAGTTCGACATGGGTGG - Intergenic
1177501953 21:21968146-21968168 CTTTGCAAGTGATACATGGTAGG + Intergenic
1178167026 21:29990991-29991013 CTAAGTAAGTAATACATGGGTGG + Intergenic
1185331373 22:50253466-50253488 CTTTGTAAGTAACACCTGGCGGG + Exonic
949834130 3:8249672-8249694 CTATGAAAGTTTTACCTGTGGGG + Intergenic
950489122 3:13292183-13292205 GTTTGTAAGTTATATGTGTGTGG - Intergenic
955832942 3:63024032-63024054 CATGGTAAGCTATAGCTGGGAGG + Intergenic
956836628 3:73101090-73101112 TTTATTAAGTTATACATGGGAGG - Intergenic
962599837 3:136983386-136983408 CTTTGTAAGATAGACCTGGTCGG - Intronic
964731408 3:159870392-159870414 CTTTGTAAGTTATACCTGGGAGG - Intronic
971342815 4:25786369-25786391 CTTTCTAAGTTTTGTCTGGGTGG - Intronic
974136954 4:57830322-57830344 TTTTGTAAGTTTTTCCTGTGAGG + Intergenic
976937696 4:90658697-90658719 CTTTTTAAGTTATTCCTAGAGGG - Intronic
981115478 4:140985229-140985251 CTTTTTAAGTTAAAAATGGGAGG - Intronic
988040645 5:25885207-25885229 TTTTGAAAGTTATACTTGGGTGG + Intergenic
988186570 5:27871946-27871968 CTTTCTAGTTTATTCCTGGGAGG - Intergenic
992450692 5:76873182-76873204 CTTTGTAAATTTTTCCTGTGTGG - Intronic
993041526 5:82820145-82820167 CATTTTAACTTATACATGGGAGG + Intergenic
993985366 5:94591054-94591076 CTTTTTAAGGTATATCTGGAGGG - Intronic
995440798 5:112190295-112190317 CTTTGTAAGTTTTAAGGGGGGGG + Intronic
1004248839 6:14005658-14005680 CTTTATCATTCATACCTGGGAGG - Intergenic
1006536724 6:34705123-34705145 CAATCTAAGTTCTACCTGGGGGG + Intergenic
1006690225 6:35877360-35877382 CATTGTAAGTTTTACCTTGTTGG - Intronic
1007132843 6:39492707-39492729 CATTGTATGTTATACATGTGTGG + Intronic
1021226971 7:18039272-18039294 CTTTTTATGTTGTGCCTGGGAGG + Intergenic
1023599640 7:41868850-41868872 CATTGTCAGATATTCCTGGGAGG + Intergenic
1024111810 7:46154697-46154719 CTTTGTACGATGTACATGGGTGG - Intergenic
1026965229 7:74435160-74435182 CTTACTAAGTTATTCCGGGGAGG + Intergenic
1027692393 7:81364519-81364541 CTTTGGAAGTCATTCCTGGAAGG - Intergenic
1031909417 7:127499400-127499422 CTTTGTAGAGTATACCTGTGGGG + Intergenic
1033440930 7:141378203-141378225 CTTTGTGAGTCATACCATGGAGG + Intronic
1039117120 8:34103676-34103698 CCTTGCAAGTTATATTTGGGTGG + Intergenic
1041564952 8:59266326-59266348 CTTTGTAAGCTACAACTAGGTGG + Intergenic
1047269760 8:123345152-123345174 CTTTATATGTTACTCCTGGGAGG - Intronic
1047771538 8:128033941-128033963 ATTTGAAAGTGATTCCTGGGTGG + Intergenic
1055845221 9:80554460-80554482 CTTGGTAATTAATACCTGGTGGG + Intergenic
1187589932 X:20706767-20706789 CTTTGAAAATCATTCCTGGGAGG + Intergenic
1189076607 X:37922197-37922219 CTTTGGAAGTTCTTCCTGTGAGG + Intronic