ID: 964733190

View in Genome Browser
Species Human (GRCh38)
Location 3:159889441-159889463
Sequence CTCTAACAGAAGTGGCCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 140
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 127}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964733185_964733190 -5 Left 964733185 3:159889423-159889445 CCCAGAATAAAGAAAGACCTCTA 0: 1
1: 0
2: 2
3: 45
4: 529
Right 964733190 3:159889441-159889463 CTCTAACAGAAGTGGCCACAGGG 0: 1
1: 0
2: 0
3: 12
4: 127
964733186_964733190 -6 Left 964733186 3:159889424-159889446 CCAGAATAAAGAAAGACCTCTAA 0: 1
1: 0
2: 2
3: 66
4: 1026
Right 964733190 3:159889441-159889463 CTCTAACAGAAGTGGCCACAGGG 0: 1
1: 0
2: 0
3: 12
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964733190 Original CRISPR CTCTAACAGAAGTGGCCACA GGG Intronic
900889065 1:5436153-5436175 CTCTAACAGGACAAGCCACAGGG - Intergenic
901249886 1:7770141-7770163 CTCTGGCAGTAGTGGCCAGATGG - Intergenic
902062053 1:13653310-13653332 AGATAACAGAAGTGGCCAAAAGG + Intergenic
902849225 1:19140716-19140738 CTCTCACAGCAGTGGAAACAAGG + Intronic
903528295 1:24009923-24009945 CTATAAAAGAAGAGGTCACAGGG - Intergenic
907448915 1:54529723-54529745 CGCTAAGAGATGTGGCCAGATGG - Intergenic
914223399 1:145700407-145700429 CTCTAACAGAAGTGAACATAGGG + Intronic
917094321 1:171384957-171384979 TTCTAAGAGATGTTGCCACAAGG + Intergenic
918649123 1:186938346-186938368 TTTTACCAGAAGTGGCCAAATGG + Intronic
918690995 1:187479133-187479155 CACCAACAAAACTGGCCACATGG - Intergenic
920495474 1:206451696-206451718 CTCTAGCAGAGCTGGCCACGAGG - Intronic
921047025 1:211484997-211485019 CTCGAAGGGAAGTGCCCACAGGG + Intronic
922183666 1:223255989-223256011 CTCTAATAGCAGTGGCCACTTGG + Intronic
922570912 1:226634278-226634300 CTCTAACAGCACTGGCCGCCAGG + Exonic
924749898 1:246876787-246876809 CTGTAACAGAATTGGGAACAGGG - Intronic
1063040672 10:2334043-2334065 CTCGAAAAGTAGAGGCCACATGG - Intergenic
1064008568 10:11716863-11716885 CTCTCAAAGTAGTGGCCAGATGG + Intergenic
1064778560 10:18807704-18807726 CCCTGACTGAATTGGCCACAAGG + Intergenic
1067453241 10:46395214-46395236 CTTTACCAGAAGTGCCCAAAAGG - Intergenic
1067583994 10:47464552-47464574 CTTTACCAGAAGTGCCCAAAAGG + Intronic
1070612506 10:77943255-77943277 CTCTAACAGAGGTGGAAGCACGG - Intergenic
1074756780 10:116629634-116629656 CTCTGAGAGCAGTGGCCAAATGG + Intronic
1075187807 10:120278516-120278538 CTCAAACAGATTTGGCCTCAGGG + Intergenic
1075216306 10:120539237-120539259 CTCTAACAGCAGTGGCTCTAGGG - Intronic
1075424168 10:122328535-122328557 CTCTGACAGAAGGGACCACAGGG + Intronic
1077998472 11:7474213-7474235 CTCTTACAGAAGTTGCTGCATGG + Intergenic
1088843505 11:113646163-113646185 ATCTAACAGATGAGGACACAAGG + Intergenic
1089753316 11:120667371-120667393 CTCTGCCATCAGTGGCCACAGGG - Intronic
1091121128 11:133058530-133058552 ATAAAACAGAAGTGGACACAGGG - Intronic
1091927680 12:4369261-4369283 CTCTAAATGAAGTGGCATCAAGG - Exonic
1095750687 12:45707305-45707327 CCCTAACAGAAGTAAACACAGGG - Intergenic
1095988240 12:48015053-48015075 CTCTGACAGAGGAGGCCACCTGG + Intergenic
1096871994 12:54598620-54598642 CTCTAATGGAAATGGGCACAGGG - Intergenic
1098991944 12:77073321-77073343 AAATAGCAGAAGTGGCCACATGG - Intergenic
1099399410 12:82183616-82183638 CTCTAACACATGTGGGCATAGGG + Intergenic
1100739830 12:97579777-97579799 CTCTATCAGAAGAGGATACAAGG + Intergenic
1103197655 12:119059115-119059137 CCCAAACAGAAGTGGTTACAGGG - Intronic
1104046626 12:125167846-125167868 CTCCTGCAGAAGTGGCCACTGGG + Intergenic
1104134015 12:125920302-125920324 CTCTAACACAATTGGCTGCAGGG - Intergenic
1105953157 13:25251942-25251964 TTCCAAAAGAAATGGCCACAGGG + Exonic
1109640123 13:65180588-65180610 CTGTACCAGAAGTGGCACCAGGG - Intergenic
1110974876 13:81818582-81818604 TTCTAACAGGACTGGCTACAGGG + Intergenic
1113678603 13:112226090-112226112 CTCCAACCGATGTGGCCCCAGGG + Intergenic
1117189402 14:53275718-53275740 CTCTCATAGATCTGGCCACATGG + Intergenic
1126740852 15:51774814-51774836 CTCTACCAGAATTGCCCAGAGGG + Intronic
1138227648 16:55311419-55311441 CTTAAACAGATGTGGCCTCATGG + Intergenic
1138439501 16:57025664-57025686 CTCTGCCAGAAGTGGGCAGAGGG + Exonic
1141161418 16:81631340-81631362 CTCCAACGGAAGAGGCCAAAAGG - Intronic
1142611699 17:1111959-1111981 CACTAACAGAAGTGGAAACCCGG - Intronic
1144408076 17:14972168-14972190 CTGCAACAGATGTGACCACAGGG - Intergenic
1146505488 17:33401082-33401104 CTCTAACAGAGGAGAACACAAGG + Intronic
1148161966 17:45455320-45455342 CTCTAACGTGAGAGGCCACAGGG - Intronic
1148857489 17:50586663-50586685 GTTTAACAGAAGAGGCCACTGGG + Intronic
1150393198 17:64801969-64801991 CTCTAACGTGAGAGGCCACAGGG - Intergenic
1153389154 18:4534657-4534679 CTGTAATGGCAGTGGCCACAGGG - Intergenic
1153998508 18:10463093-10463115 CTCTAAGAGAAGGGGGCACGGGG - Intronic
1157666446 18:49491790-49491812 CTTCCACAGAAGTAGCCACACGG + Exonic
1157956016 18:52098596-52098618 CTGAAACAGAATTGGCCACCTGG + Intergenic
1158560374 18:58508298-58508320 CTCTGACAGAACTGGCTAAATGG - Intronic
1158932695 18:62336500-62336522 CACTCTCAGAAGTGACCACAGGG + Intronic
1159446194 18:68544486-68544508 CCCCATCAGCAGTGGCCACATGG + Intergenic
1160402283 18:78619877-78619899 GTGCGACAGAAGTGGCCACATGG - Intergenic
1162015884 19:7846318-7846340 CTCGAACAGAAGGGGCAGCATGG + Intronic
1163185562 19:15636671-15636693 ATCTCCCAGAAGTGGCCTCATGG - Intronic
1164958650 19:32407477-32407499 CTCCCACAGAAGTGGCCACGTGG - Intronic
1168167060 19:54556047-54556069 CTCTATCTGAAGGAGCCACAGGG + Intergenic
925098173 2:1224091-1224113 CCCTTACAGAAGAGGCCGCAGGG - Intronic
926054476 2:9766352-9766374 CTCTAACTGGAGTGGGCCCAGGG - Intergenic
929173663 2:38956473-38956495 ATGTAACAGAAGGGGCCACCAGG + Intronic
935077960 2:99764161-99764183 ATCTAAAAGCAGAGGCCACAGGG + Intronic
937150169 2:119680986-119681008 CTCTACCAGTACTGGCCTCAGGG + Exonic
941806205 2:169713911-169713933 CTCTCATAGATCTGGCCACATGG + Intronic
947639060 2:231696016-231696038 CACTCACAGAAGGGGCCACCTGG + Intergenic
948133961 2:235621785-235621807 GTCTAACAGGAGAGGGCACATGG + Intronic
1168865828 20:1085720-1085742 TACTGCCAGAAGTGGCCACATGG - Intergenic
1169875961 20:10297284-10297306 CTCTTGCTGAAGAGGCCACATGG - Intronic
1177214953 21:18116235-18116257 TTCCAACAGAAGGGGCCATATGG - Intronic
1178159456 21:29894799-29894821 CTCAAACAGAAGTGGATCCAGGG - Intronic
1180907307 22:19423571-19423593 CTCTAACAGAAGGTCTCACATGG - Intronic
1184839509 22:47044222-47044244 CTCTAGCAAAAGGGGCCAGAGGG - Intronic
950489878 3:13297710-13297732 CTCTATCTGGAGTGACCACAGGG - Intergenic
952528840 3:34242456-34242478 CTCTAGCAGGAGTGGCCAAATGG + Intergenic
955120372 3:56052259-56052281 CTCAAAATGATGTGGCCACATGG + Intronic
957129725 3:76207709-76207731 CTGTAACAGAAGTGTCCGTAGGG + Intronic
959629293 3:108490391-108490413 CTCCCACAGAAGTGGACATAGGG - Intronic
960421755 3:117455061-117455083 CTCTAGCACTAGTGGCCTCACGG + Intergenic
960864825 3:122188807-122188829 CACTAACTGAGGTGTCCACATGG + Intronic
961404274 3:126667550-126667572 TCCTAACAGAAGTGGCCATGTGG + Intergenic
964626308 3:158763448-158763470 TTCTAGCAAAAGTGGCCTCAGGG - Intronic
964733190 3:159889441-159889463 CTCTAACAGAAGTGGCCACAGGG + Intronic
964840978 3:160993455-160993477 TCCGAACAGAAGTGGTCACAAGG + Intronic
965297605 3:166969534-166969556 TACTAACACAGGTGGCCACAAGG - Intergenic
966745490 3:183271508-183271530 CTCTAACACCAGTAGCTACATGG - Exonic
967219869 3:187239519-187239541 CCCTTCCAGAGGTGGCCACATGG + Intronic
971957907 4:33446256-33446278 TTTTATCAGAAGTGGCCAGAAGG - Intergenic
973147097 4:46840766-46840788 CAGTAACAGAAGTGGACATAAGG + Intronic
975571029 4:75818038-75818060 CTCTAACTGAAAGGGCCACTTGG + Intergenic
979902060 4:126233906-126233928 TACTAACTGTAGTGGCCACATGG - Intergenic
985861368 5:2473786-2473808 CTGTAAGTGAAGGGGCCACAGGG - Intergenic
986913357 5:12585436-12585458 CCCTAATAGTGGTGGCCACAGGG - Intergenic
989063471 5:37433785-37433807 CTGTAACAGAAGTATACACAGGG - Intronic
992565534 5:77992182-77992204 TTTTTGCAGAAGTGGCCACAGGG - Intergenic
993649129 5:90496645-90496667 TTCTAACAGTATTGGCCACATGG - Intronic
994889025 5:105605344-105605366 TCCTAACAGTGGTGGCCACAGGG + Intergenic
998069500 5:139186021-139186043 CATTAACAGAAGTGGCCTCTGGG + Intronic
999770911 5:154774810-154774832 CTGTAAAAGAAGTGACCAGACGG - Intronic
1000568021 5:162875240-162875262 CCATACCAAAAGTGGCCACATGG + Intergenic
1004484252 6:16050927-16050949 CTCTAACAGAAGTTGAAACCAGG - Intergenic
1005696184 6:28354793-28354815 CTCTCATAGATCTGGCCACATGG + Intronic
1007016022 6:38467654-38467676 TTGTAACTGAAGTGTCCACAAGG - Intronic
1008940387 6:57040136-57040158 ATCTACCAGCAGTGGCCACATGG + Intergenic
1011229039 6:85139277-85139299 CTCTAACAGAAATAGGGACATGG - Intergenic
1012909059 6:105099354-105099376 CTCTAACAGAAATCACCTCATGG + Exonic
1013457552 6:110344383-110344405 CTGCTACAGAAGTGGCCTCAGGG - Intronic
1014312048 6:119815654-119815676 TTCTAACAGCTGTGGCCAGAAGG - Intergenic
1016013445 6:139161503-139161525 GTCTAACAGAAGTGCACACATGG - Intronic
1019146443 6:169978209-169978231 CCCTAACAGAAGTGGGAACTCGG + Intergenic
1021759189 7:23886761-23886783 CTTTAAGAGAACTGGCCACAAGG + Intergenic
1023171272 7:37392242-37392264 CTCTAACTCAAGTTCCCACATGG + Intronic
1030408449 7:109144008-109144030 CTCTTCCAGCAGTGGCAACATGG - Intergenic
1033013862 7:137651655-137651677 CTCTAACAGGAGTGGGCAGACGG + Intronic
1035247424 7:157572873-157572895 CTCTAACAGAAACGGTGACACGG - Intronic
1041004619 8:53486483-53486505 CTCTCATAGATCTGGCCACATGG - Intergenic
1045880738 8:107036098-107036120 CTCTAATCAAAGTGGCCAGATGG + Intergenic
1046110038 8:109711873-109711895 CTGTCACAGCAGTGGCCAGATGG - Intergenic
1048384492 8:133898970-133898992 CTGTAACTGAAGTTGCCACCTGG + Intergenic
1050388992 9:5117091-5117113 CTCTAAAAGATGTGGCAACAAGG + Intronic
1050652271 9:7787824-7787846 CTCTCATAGATCTGGCCACATGG + Intergenic
1051108267 9:13605113-13605135 CTCTAACAGAACTAGACATAAGG - Intergenic
1052528499 9:29652299-29652321 CTCTAAAAGAAATGACCAAAAGG - Intergenic
1059954044 9:119497315-119497337 CTCCAACCCAAGGGGCCACAGGG + Intronic
1060214151 9:121728309-121728331 CTCTAACTGATGAGCCCACAGGG - Intronic
1185874064 X:3687884-3687906 CTCCAAGAGAGGTGGCTACATGG + Intronic
1187575136 X:20546047-20546069 CCCCGACAGAACTGGCCACAAGG - Intergenic
1187797455 X:23019911-23019933 CTCAAACAGAAGGGGAAACAGGG + Intergenic
1189329691 X:40135988-40136010 CTCTAAAAGGTGTGGACACAGGG - Intronic
1189987823 X:46569833-46569855 GTCAAAGAGAAGTGGCCACATGG - Intergenic
1190502944 X:51097270-51097292 CCCTCACAGAGCTGGCCACATGG + Intergenic
1199001666 X:142645874-142645896 CTCTAACATAAGAGACTACATGG + Intergenic
1199565534 X:149211874-149211896 CTGCAAGAGAAGTGGCCCCAAGG + Intergenic