ID: 964735271

View in Genome Browser
Species Human (GRCh38)
Location 3:159911044-159911066
Sequence CTTCACATGCACAGTATGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964735269_964735271 -3 Left 964735269 3:159911024-159911046 CCCAAAATGTGGTTTCTTGACTT No data
Right 964735271 3:159911044-159911066 CTTCACATGCACAGTATGAATGG No data
964735270_964735271 -4 Left 964735270 3:159911025-159911047 CCAAAATGTGGTTTCTTGACTTC No data
Right 964735271 3:159911044-159911066 CTTCACATGCACAGTATGAATGG No data
964735268_964735271 6 Left 964735268 3:159911015-159911037 CCTCTACAACCCAAAATGTGGTT No data
Right 964735271 3:159911044-159911066 CTTCACATGCACAGTATGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964735271 Original CRISPR CTTCACATGCACAGTATGAA TGG Intergenic
No off target data available for this crispr