ID: 964735492

View in Genome Browser
Species Human (GRCh38)
Location 3:159912918-159912940
Sequence TACCCACAAGGTTTTTATAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964735486_964735492 11 Left 964735486 3:159912884-159912906 CCACTCTGAGCCTCGGTTTCCCT No data
Right 964735492 3:159912918-159912940 TACCCACAAGGTTTTTATAAGGG No data
964735487_964735492 1 Left 964735487 3:159912894-159912916 CCTCGGTTTCCCTGTCTTTTGCA No data
Right 964735492 3:159912918-159912940 TACCCACAAGGTTTTTATAAGGG No data
964735489_964735492 -9 Left 964735489 3:159912904-159912926 CCTGTCTTTTGCAGTACCCACAA No data
Right 964735492 3:159912918-159912940 TACCCACAAGGTTTTTATAAGGG No data
964735488_964735492 -8 Left 964735488 3:159912903-159912925 CCCTGTCTTTTGCAGTACCCACA No data
Right 964735492 3:159912918-159912940 TACCCACAAGGTTTTTATAAGGG No data
964735484_964735492 30 Left 964735484 3:159912865-159912887 CCTCACACAAGTTGCTGAACCAC No data
Right 964735492 3:159912918-159912940 TACCCACAAGGTTTTTATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964735492 Original CRISPR TACCCACAAGGTTTTTATAA GGG Intergenic
No off target data available for this crispr