ID: 964739954

View in Genome Browser
Species Human (GRCh38)
Location 3:159954716-159954738
Sequence ATGTATGAACAGAAGGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964739951_964739954 7 Left 964739951 3:159954686-159954708 CCTTCATACATCGTGAGAGGGGC No data
Right 964739954 3:159954716-159954738 ATGTATGAACAGAAGGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964739954 Original CRISPR ATGTATGAACAGAAGGAGGC AGG Intergenic
No off target data available for this crispr