ID: 964741940

View in Genome Browser
Species Human (GRCh38)
Location 3:159975425-159975447
Sequence GAGACAGTGTTAGATCCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964741940_964741944 30 Left 964741940 3:159975425-159975447 CCTGTAGGATCTAACACTGTCTC No data
Right 964741944 3:159975478-159975500 CATACCCAGTTGGTGTCTGTTGG No data
964741940_964741943 20 Left 964741940 3:159975425-159975447 CCTGTAGGATCTAACACTGTCTC No data
Right 964741943 3:159975468-159975490 TGAATGATAGCATACCCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964741940 Original CRISPR GAGACAGTGTTAGATCCTAC AGG (reversed) Intergenic
No off target data available for this crispr