ID: 964743092

View in Genome Browser
Species Human (GRCh38)
Location 3:159988059-159988081
Sequence CTTTCTGTGCTGAGAGTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 1, 2: 5, 3: 48, 4: 313}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964743092_964743094 -6 Left 964743092 3:159988059-159988081 CCCACTACTCTCAGCACAGAAAG 0: 1
1: 1
2: 5
3: 48
4: 313
Right 964743094 3:159988076-159988098 AGAAAGTACACTCCTTAGTATGG 0: 1
1: 0
2: 2
3: 33
4: 298
964743092_964743096 12 Left 964743092 3:159988059-159988081 CCCACTACTCTCAGCACAGAAAG 0: 1
1: 1
2: 5
3: 48
4: 313
Right 964743096 3:159988094-159988116 TATGGCATCCCCTGCCCTCATGG 0: 1
1: 0
2: 0
3: 22
4: 235
964743092_964743097 17 Left 964743092 3:159988059-159988081 CCCACTACTCTCAGCACAGAAAG 0: 1
1: 1
2: 5
3: 48
4: 313
Right 964743097 3:159988099-159988121 CATCCCCTGCCCTCATGGCATGG 0: 1
1: 0
2: 4
3: 24
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964743092 Original CRISPR CTTTCTGTGCTGAGAGTAGT GGG (reversed) Intergenic
900519135 1:3097280-3097302 CTTTCTGTACTCAGAGGAATTGG - Intronic
903882669 1:26522209-26522231 CTTTCAGGTCTGAGAGAAGTGGG + Intergenic
904368339 1:30032567-30032589 CTTTCTGTGCAGTGAGCAATAGG + Intergenic
905216830 1:36414612-36414634 CTTTCTGTGCGGTGAGCAGCAGG + Intergenic
905568153 1:38982421-38982443 CTTTCTGTGCTGTGAACAGTAGG + Intergenic
905661588 1:39730425-39730447 CTTTCTGTGCTGTGAGCAGCAGG + Intronic
907097140 1:51792126-51792148 GTTTCTCTGCTGGGAGGAGTTGG - Intronic
908540915 1:65121228-65121250 CTTTCTTTGCTTGAAGTAGTAGG - Intergenic
909181882 1:72434745-72434767 CTTTCAGTGCTGAGCCTTGTAGG - Intergenic
909254802 1:73406539-73406561 CTTTCTATACTGTGAGTAGCAGG + Intergenic
912979685 1:114360017-114360039 CTTTCTGTGTTGATAGTTGTGGG + Intergenic
913792126 1:122547165-122547187 CTTTCTTTTCATAGAGTAGTTGG + Intergenic
913835259 1:123320338-123320360 CTTTCTTTTCATAGAGTAGTTGG + Intergenic
913835642 1:123327142-123327164 CTTTCTGTTCATAGAGCAGTTGG + Intergenic
914436634 1:147666342-147666364 CTTTCTGTGTTGAGAGAACTAGG - Intronic
915242980 1:154537074-154537096 CCTTCTGGGCTGACAATAGTAGG - Intronic
915342675 1:155184989-155185011 GTTTCTGTGCTGGGTGTGGTAGG + Intronic
915680471 1:157577172-157577194 CTTTCTGAGGTGAGAGTAGCAGG + Intronic
917409470 1:174743037-174743059 CTTTCTGTGCTGTGAGCAGCAGG - Intronic
919178201 1:194047108-194047130 CTTTCTGTGCGGTGAGCAGCAGG - Intergenic
919280343 1:195482096-195482118 CTATCTGTGAAGAGAGAAGTGGG + Intergenic
922247450 1:223814176-223814198 TATTTTGTGCTGGGAGTAGTAGG - Intronic
922449274 1:225723701-225723723 CTTTCTGTGCAGCGAGAAGCAGG + Intergenic
923885780 1:238153770-238153792 CTCTCTGTGCACAGAGTAGGCGG + Intergenic
924334354 1:242972264-242972286 CTTTCTGTGCAAAGAGCAATAGG + Intergenic
924635006 1:245777862-245777884 TGTTTTGTTCTGAGAGTAGTTGG - Intronic
924853387 1:247853326-247853348 CTTTCTGTGTGGAGAGCAGCAGG + Intergenic
1062931181 10:1353741-1353763 GTTTCTGTGATGTGTGTAGTTGG - Intronic
1062956865 10:1546288-1546310 CTTTCCGTGCAGAGAGCAGCAGG + Intronic
1063158891 10:3404841-3404863 CTCTGTGTGCTGAGAAAAGTGGG - Intergenic
1063759163 10:9052732-9052754 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1065835782 10:29656829-29656851 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
1068088341 10:52402179-52402201 CTTTCTGTGAGGAGAGGAGATGG - Intergenic
1068700641 10:60016003-60016025 CTTTCTGTGCAGCGAGCAGCAGG + Intergenic
1069092602 10:64219762-64219784 GTTTCTGTGGTTCGAGTAGTTGG + Intergenic
1070649984 10:78228415-78228437 CTTTGTGTGCTGGGAGAAGGAGG + Intergenic
1070973686 10:80588065-80588087 CTTTCTGTGCCGCAAGCAGTAGG - Intronic
1071056221 10:81510840-81510862 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1071073525 10:81724781-81724803 CTTTCTGTGCAGAGAGCTGCAGG + Intergenic
1071591571 10:86879427-86879449 TTATCTCTGCTGAGAGTAGAGGG + Intronic
1072830166 10:98648964-98648986 CTATGAGTGCTGAGAGTTGTAGG - Intronic
1073260386 10:102185518-102185540 CTTTCTGTGCAGCGAGCTGTAGG + Intergenic
1073522244 10:104143861-104143883 CTGTCAGTGCTGACAATAGTTGG - Intronic
1074563777 10:114558106-114558128 CTTTCTGTGCAGCGAGCAGCGGG + Intronic
1075246068 10:120823165-120823187 CCTTCTGTGCTGTGAATGGTTGG + Intergenic
1075307892 10:121384078-121384100 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1075372965 10:121953471-121953493 ATTTCTGTGCTGAGGGTGGTAGG - Intergenic
1076287907 10:129319070-129319092 CTTTCTGTGCTGAGAGCAGCAGG - Intergenic
1076797002 10:132803244-132803266 CCTTCTGTCCTGAGGGTTGTGGG + Intergenic
1077168734 11:1156983-1157005 CTTTCTGTGCTGGGACTGCTCGG + Intergenic
1077269602 11:1669328-1669350 CTTTCTGTGCAGAGAGCAGGGGG + Intergenic
1077863256 11:6201385-6201407 CTATCTGTGCTGAGTGGACTGGG - Intergenic
1078627120 11:12967893-12967915 CATTCTGTGCTAAGAATAGCAGG - Intergenic
1078955809 11:16193583-16193605 ATGTCTGTGTTTAGAGTAGTGGG + Intronic
1079724961 11:23869244-23869266 CTTTCTGTGCAGCAAGTAGTAGG + Intergenic
1080599389 11:33807687-33807709 CTTTCTGTGCCGTGAGCAGCAGG - Intergenic
1081131264 11:39383179-39383201 CTTTCTGTGCTGCAAGTAAAGGG - Intergenic
1081598409 11:44475247-44475269 CTTTCTATCCTGGGAGAAGTAGG - Intergenic
1081796957 11:45827087-45827109 CTTTCTGTTCTGAGAAGACTTGG + Intergenic
1084711489 11:70846659-70846681 CCTTCTGTGCTGAGATGAGGTGG - Intronic
1085588613 11:77735207-77735229 CGTTCTTTGCCGAGAGTCGTCGG - Intronic
1087440946 11:98183217-98183239 CTTTCTGTGCTGTGAGCAGCAGG - Intergenic
1091265513 11:134268201-134268223 CTTTCTGTGCGGTGAGCAGCAGG - Intergenic
1093706019 12:22275833-22275855 CTTGGCTTGCTGAGAGTAGTGGG - Intronic
1094295988 12:28905568-28905590 GTTTCTGTGCTGAGGATAATAGG - Intergenic
1094433718 12:30398290-30398312 CTTTCTGTGTGGTGAGTAGCAGG - Intergenic
1097555984 12:61138280-61138302 CTTTCTGTTCTGTGAGCAATGGG - Intergenic
1098881711 12:75924210-75924232 CTTTCTGTGCAGAGAGCAATGGG - Intergenic
1099517486 12:83615394-83615416 CTTTCTGTACAGAGAGCAGCAGG + Intergenic
1100705080 12:97191767-97191789 CTTTCTGTGCAGTGAGCAGAAGG + Intergenic
1100960032 12:99952590-99952612 CTTTCTCTGCTGTGGGAAGTTGG - Intronic
1101022794 12:100571030-100571052 CTTTCTGTGCTGCAAGCAGCAGG - Intergenic
1101844189 12:108349441-108349463 CTTTCTGTACTAAGAGGAGGAGG - Intergenic
1102612818 12:114127628-114127650 ATTTCTGTGCACAGAGCAGTTGG - Intergenic
1103133029 12:118485087-118485109 CTTTCTTTTCTCAGATTAGTGGG - Intergenic
1104036431 12:125100614-125100636 ATTTCTGTGCTAAGAGTTCTAGG - Intronic
1104120109 12:125790865-125790887 CTTTCTGTGCAGTAAGCAGTAGG + Intergenic
1104125379 12:125841133-125841155 CTTTCTGTGCAGTGAGTACCAGG - Intergenic
1104309333 12:127640256-127640278 AATTTTGTGCTGAGAGTAGCTGG + Intergenic
1104328688 12:127824302-127824324 CTTTCTGTGATGTGAGCAGCAGG + Intergenic
1104658094 12:130589030-130589052 CTTTCTGTCCTAAGAGAAGTCGG + Intronic
1105721943 13:23125325-23125347 CTTTCTGTGCTTTGAGCAGCAGG + Intergenic
1106572537 13:30940279-30940301 CAACCTGAGCTGAGAGTAGTGGG + Intronic
1106639618 13:31570117-31570139 CTTACTGGGGTGGGAGTAGTGGG + Intergenic
1106822706 13:33483825-33483847 CTTTCTGTGCTGCAAGCAATGGG + Intergenic
1108846657 13:54686452-54686474 CTTTCTGTGCTACGAGCAGCAGG + Intergenic
1109198520 13:59405948-59405970 CTTTCTGTGCAGCAAGCAGTAGG - Intergenic
1109522129 13:63527452-63527474 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1110520766 13:76473326-76473348 CTTTCTGTGCTGCAAGCAGCAGG + Intergenic
1110537376 13:76667145-76667167 CTTTCTGTGCAGCGAGCAGCAGG - Intergenic
1111201909 13:84949071-84949093 CTTTCTTTGCAGAGAGCAGCAGG + Intergenic
1111272829 13:85909857-85909879 CTTTCTGTGCTATGAGCAATGGG - Intergenic
1111352425 13:87048657-87048679 CTTTCTGTGTGGAGAGCAGCAGG - Intergenic
1111525735 13:89466754-89466776 CTTTCTGTGCCATGAGCAGTAGG - Intergenic
1111558628 13:89913819-89913841 CTTTCTGTGCTGAGAGCAGCGGG + Intergenic
1115579542 14:34744533-34744555 ATTTCTTTGCTGAGTGCAGTAGG + Intergenic
1116094071 14:40345715-40345737 CTCTTTGTGCTGAGAGTTCTGGG + Intergenic
1118506440 14:66418089-66418111 CTTTCTGTACTGAGAGAAGTTGG - Intergenic
1119324179 14:73749792-73749814 CTTTCTGAGCTGAGAGAACTTGG - Intronic
1119689286 14:76658209-76658231 CTGTCTGTGGAGAGAGTAGAAGG + Intergenic
1119763954 14:77176244-77176266 TTTCCTGTGCAGAAAGTAGTGGG - Intronic
1121062000 14:90920489-90920511 CTTTCTGTGCTGAGGATACTTGG - Intronic
1124062845 15:26310722-26310744 CTTTCTGTGCTGTGAGCAGCAGG + Intergenic
1124069278 15:26376490-26376512 CTTTCTGTGCAGTGAGCAGCTGG - Intergenic
1124110724 15:26783126-26783148 CTTTCTTTTCTGATATTAGTAGG + Intronic
1124141051 15:27077540-27077562 CTTTCTGTGCTGACCTTCGTGGG + Intronic
1125598277 15:40901218-40901240 CTCTCTGTGCTCAGATTATTTGG + Intronic
1126559759 15:50030488-50030510 CATTCTGTGCTCAGTGTAGCTGG - Intronic
1127261629 15:57330950-57330972 CTTTTTGTGGTGAGAGGGGTGGG - Intergenic
1128473591 15:67977414-67977436 CTTTCTGTGCTGTGAGCAGCAGG - Intergenic
1128729086 15:70008559-70008581 CTTTCTGTGTTCAGAGTGTTTGG + Intergenic
1130690176 15:86075534-86075556 ATTTCTTTCCTGAGAGTAGAAGG - Intergenic
1131738690 15:95362563-95362585 CTTTCTGTGCTGCGAGCAACAGG + Intergenic
1131939533 15:97545748-97545770 CTTTCTGTGCTGTGAGAAAATGG - Intergenic
1134226109 16:12391418-12391440 TTTTCTGTACAGAGAGTAGAAGG + Intronic
1134355264 16:13476459-13476481 CTTTCTGTACAGAGAGTAACAGG + Intergenic
1134597394 16:15506871-15506893 CTTTCTGTGCAGCGAGTAGCAGG + Intronic
1135921333 16:26651380-26651402 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1135927123 16:26705287-26705309 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1136556927 16:31012383-31012405 CTTTCTGTGCTTTGAGTGGCTGG - Intergenic
1138300188 16:55919510-55919532 GGTTCTGGGCTGAGAGTCGTAGG - Intronic
1138845412 16:60559102-60559124 CTTTCTGACCTCAGAGTTGTTGG + Intergenic
1140221855 16:73049235-73049257 CTTTCTGTGCTGTGAGAATCGGG - Intronic
1142644829 17:1304917-1304939 CCTGGTGTGCTGAGGGTAGTTGG + Intergenic
1143988192 17:10933617-10933639 CTTTCTCTGCTGGGAGCTGTAGG + Intergenic
1144530315 17:16032322-16032344 CGTACTGTGCTGAGAGCAGTGGG + Exonic
1145183454 17:20773352-20773374 CTTTCTGTGCAGAGAGCAGCAGG + Intergenic
1146745489 17:35324929-35324951 CTTTCTGTGCAGGGAGCAGCAGG + Intergenic
1150544315 17:66138034-66138056 CTTTCTGTGCGGTGAGCAATGGG - Intronic
1152849828 17:82626770-82626792 TTTTCTGTGTTGAAAGTAGCAGG - Intronic
1153915566 18:9741571-9741593 CTTTCTGTGCTGGGAGGAAGGGG + Intronic
1154295522 18:13143612-13143634 CTTTCTGTGCTGTGAGCAGCAGG - Intergenic
1155149063 18:23108084-23108106 CGTTCTCTCCTGAGAGTAGAGGG - Intergenic
1155910577 18:31499966-31499988 ATTTTTGTCCAGAGAGTAGTGGG + Intronic
1155999497 18:32369372-32369394 CTGTCTGTGCTGAAATTAGAAGG - Intronic
1156788417 18:40943417-40943439 CTTTCTGTGTTGTGGGCAGTTGG - Intergenic
1157206959 18:45708992-45709014 CTTTCTGTGGGGTGAGCAGTAGG - Intergenic
1157889248 18:51399184-51399206 CTCTCTGTGCTCAGGGTACTGGG + Intergenic
1159327295 18:66938641-66938663 CTTTCTGTGCAGCGAGCAGCAGG + Intergenic
1163104848 19:15117280-15117302 CTCTCTGTCCTGAGGGCAGTGGG + Intronic
1165036876 19:33040115-33040137 CCTGTTGTGCTGAGAGTTGTTGG - Intronic
1166468448 19:43055987-43056009 CTTTCTGTGCAGTGAGCAATGGG - Intronic
1166474905 19:43115215-43115237 CTTTCTGTGCAGTGAGCAATGGG - Intronic
1168532656 19:57142084-57142106 CTTTCTGTGCAGCCAGTAGCAGG + Intronic
925074065 2:997452-997474 CTGTCTGTGGTGAGAGCAATTGG + Intronic
925931013 2:8707955-8707977 CTTTCTGTGCTGGGAGCAGCAGG + Intergenic
926626444 2:15094647-15094669 CTTTTTGTGCTGAGAATATGCGG + Intergenic
928346400 2:30501258-30501280 CTTTCTGTGCTGCAAGCAGCAGG + Intronic
928697313 2:33862318-33862340 CTTTCTGTGTGGTGAGCAGTAGG - Intergenic
929394827 2:41510691-41510713 CTTTCTGTGCGGTGAGCAGCAGG - Intergenic
929490581 2:42392524-42392546 CTTTCTATGCTGCCAGCAGTAGG - Intronic
930086337 2:47500096-47500118 CTTTCTGTGCGGTGAGCAGCAGG + Intronic
932860951 2:75290703-75290725 ATTTCTGTGCTCAGAGTAGTGGG - Intergenic
933453561 2:82491563-82491585 CTTTCTTTGCGGTGAGTAGCAGG - Intergenic
933496639 2:83058220-83058242 CTTTCTGTGTGGTGAGCAGTGGG - Intergenic
933792721 2:85895966-85895988 CTTTCTGTGCTGGGAGTAGTGGG - Intergenic
933802368 2:85972753-85972775 CTTTCTGTGCTGTGAGCAGCAGG + Intergenic
934544569 2:95204114-95204136 CTTCCTGTGCTGTGAGTGGCAGG + Intergenic
935765640 2:106365038-106365060 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
935962213 2:108436946-108436968 CTTTCTGTGTGGAGAGCAGCAGG - Intergenic
936467693 2:112767807-112767829 CTTTCTGTGCAGCGAGCAGCAGG - Intergenic
937459543 2:122074237-122074259 CTTCCTGAGCTCAGAGTAGGGGG + Intergenic
937558504 2:123190588-123190610 CCTTCTTTGCTGAGAGTTTTTGG - Intergenic
937619705 2:123971498-123971520 CTTTCTGTGCAGTGAGCAATGGG - Intergenic
939144629 2:138397137-138397159 CTCTCTGTGCTTGGAGTTGTGGG - Intergenic
940943293 2:159587756-159587778 CTTTCTGTTCGCAGACTAGTAGG - Intronic
942493279 2:176511092-176511114 CTTACTTTGCTCAGAGTAGAAGG + Intergenic
944710142 2:202328185-202328207 CTTTCTTTTCTGAGAGAAGGTGG - Intergenic
945737809 2:213622551-213622573 CTTTCTGTGCGGTGAGCAGCAGG + Intronic
946680206 2:222205883-222205905 CTTTCTGTGCACAAAGAAGTTGG + Intronic
946938117 2:224742862-224742884 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
947020859 2:225674100-225674122 CTTTCTGCTCTGAGAGCTGTGGG + Intergenic
947483130 2:230521628-230521650 CTTTCTGTGCAGTGAGCAGCTGG + Intronic
947890776 2:233617271-233617293 CTTTCTGGACAGAGAGTATTTGG + Intergenic
947892388 2:233636102-233636124 CTTTCTGGACAGAGAGTATTTGG + Intronic
1169304035 20:4472850-4472872 CTTTCTGGGGTGAGAGAAGGAGG - Intergenic
1169762855 20:9115162-9115184 GTTTCTATGCTGAGAACAGTGGG + Intronic
1170231140 20:14048114-14048136 CTTTCTGTGCAGTGAGCAGCAGG - Intronic
1171025706 20:21628746-21628768 CTTTCTGTGCTGCAAGCAATGGG + Intergenic
1173713284 20:45179148-45179170 CTTTCGGTGCTGAGACTTGCAGG - Intergenic
1175125724 20:56750309-56750331 ATTTCTGTGCTAAGTGTAATTGG + Intergenic
1177385024 21:20397298-20397320 CTTTCAGTGCAGAGGGGAGTTGG + Intergenic
1178032717 21:28546117-28546139 CTTTCTACTCAGAGAGTAGTGGG + Intergenic
1178580941 21:33838177-33838199 TTTTCTGTGCTGTGAGCAGCAGG - Intronic
1178790069 21:35691677-35691699 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
1178835486 21:36094041-36094063 CTTTCTGTGCAGTGAGAAGCGGG + Intergenic
1180122809 21:45765244-45765266 ATATCTGTGCTGAGAGGAGAGGG + Intronic
1181138847 22:20788611-20788633 CTTACTCTGCTGAGAGCAGATGG + Intronic
1182180532 22:28342975-28342997 CTTTATTTTGTGAGAGTAGTTGG - Intronic
1182686883 22:32128071-32128093 CCTTCTGTGCTGAATGTGGTGGG - Intergenic
1182714728 22:32348398-32348420 CCTTCTGTGCTGAGTCTGGTGGG + Intergenic
1182733692 22:32515250-32515272 CTGTCTGTCCTGTGATTAGTTGG + Intronic
1184846933 22:47093864-47093886 CTTTCTGTGCAGTGAGCAGCAGG - Intronic
1184950787 22:47841276-47841298 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
949134827 3:551723-551745 CTTTCTGTGCGGAGAGCAGCAGG + Intergenic
949302737 3:2603413-2603435 TTTTCTGTGGTGAGAGAAGCAGG + Intronic
949761055 3:7471433-7471455 GTTTCTCTGCTGACAGTGGTGGG + Intronic
950187498 3:10954055-10954077 CATGCTGTGCTGAGAGCAGCTGG - Intergenic
950454851 3:13086583-13086605 CTTTCGGTTCTGAGTGCAGTGGG - Intergenic
951874240 3:27403843-27403865 CTTTCTGTGGTGATAATGGTGGG - Intronic
952389588 3:32868787-32868809 CTTTCTGTGGTGGGAGTATGAGG - Intronic
953312538 3:41893014-41893036 CTTTCTGTGCTGTGAGCAACAGG + Intronic
954988363 3:54815998-54816020 ATTTCTGTGTTGAGAGTATTAGG - Intronic
955732762 3:62004665-62004687 CTTTCTGTGCAGCGAGCAGCCGG + Intronic
956039079 3:65127266-65127288 CTTTTTGAGCTGGGAGAAGTTGG + Intergenic
956536464 3:70282232-70282254 CTTTCTGTGCAGTGAGCAATGGG + Intergenic
958781872 3:98552442-98552464 CTTTCTGTGCTGTGAGCAGCAGG - Intronic
959417802 3:106098468-106098490 CTTTCTGTGCTGTGAGCAGCAGG + Intergenic
959478196 3:106837860-106837882 CTTTCTGTGCAGTGAGCAATGGG - Intergenic
961372738 3:126441296-126441318 CTTTCTATGCTGAAGGTGGTGGG - Intronic
961747008 3:129070477-129070499 CTTTCTGTGCAGTGAGCAGCGGG - Intergenic
961981345 3:131082466-131082488 CTTTCTGTGCTGATGGAAATGGG + Intronic
961991881 3:131200855-131200877 CTTTCTGTGCTGCGAGCAGCAGG + Intronic
964137640 3:153363235-153363257 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
964743092 3:159988059-159988081 CTTTCTGTGCTGAGAGTAGTGGG - Intergenic
964751686 3:160059502-160059524 CTTTCTGTGCTGTGAGCAGCAGG - Intergenic
964869612 3:161298954-161298976 CTTTCTGTGCAGTGAGCAGTAGG - Intergenic
966221353 3:177554421-177554443 CTTTCAGTGCTGAAGGTACTTGG + Intergenic
967590785 3:191271464-191271486 CTTTCTGTGCAGTGAGCTGTAGG + Intronic
967629805 3:191732295-191732317 TTTTCTTAGCTGAGAGTAGAAGG - Intergenic
968025726 3:195441823-195441845 CTTTCTGTTTTGAGGATAGTAGG - Intronic
970459069 4:16254819-16254841 CTTTCTGAGCTGGTAGTAGAGGG + Intergenic
970720351 4:18981001-18981023 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
972652015 4:41027203-41027225 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
974110407 4:57519160-57519182 GATTCTGGGCTGAGACTAGTGGG - Intergenic
974553948 4:63418867-63418889 CTTTCTGTGTGGTGAGCAGTAGG + Intergenic
974618437 4:64322363-64322385 CTTTCTGTGCAGTGAGCAGCAGG + Intronic
975737763 4:77398145-77398167 CTTTCTGTCCTGAGATCAGGTGG + Intronic
979242756 4:118463022-118463044 CTTTCTGTGCAAAGAGCAATAGG - Intergenic
979400471 4:120243395-120243417 GTTTGTGTGCTGAGAATTGTGGG - Intergenic
980279627 4:130703260-130703282 CTTTCTGTGCAGTGAGCAGTAGG + Intergenic
980494347 4:133571966-133571988 CTTTCTGTGCAGTGAGTTGCAGG - Intergenic
982102042 4:151977537-151977559 CTTTCTGTGGTGTGAGCAGCAGG - Intergenic
983066975 4:163222403-163222425 CTTTCTGTGCTGTGAGCAGCAGG + Intergenic
983417407 4:167476217-167476239 TTTTGTGTTCTGAGAGAAGTTGG - Intergenic
983474182 4:168194618-168194640 CTTTCTGTGCAGTGAGCAGTAGG + Intergenic
983735838 4:171058855-171058877 CTTTCTGTGCAGACTCTAGTTGG - Intergenic
983892726 4:173047298-173047320 CTTTCTGTACTGAGGTCAGTTGG - Intergenic
984030928 4:174603167-174603189 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
984173219 4:176385456-176385478 CAGTCTGTGTTGAGAATAGTTGG + Intergenic
984783673 4:183549059-183549081 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
984805592 4:183748594-183748616 CTTTCTGTGCGGCGAGCAGCAGG - Intergenic
984955162 4:185037726-185037748 CTTTCTGTGCGGCGAGCAGCAGG + Intergenic
985104831 4:186490089-186490111 CTTTCTGTGCGGTGAGCAGCAGG + Intronic
985284793 4:188326031-188326053 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
985295248 4:188430987-188431009 CTTTCTGTGCAGCGAGTAGCAGG - Intergenic
985411836 4:189693797-189693819 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
985508029 5:295768-295790 CTTTCTGTGTGGAGAGCAGCGGG - Intronic
985740006 5:1609901-1609923 CTTTCTGTGTGGAGAGCAGCGGG + Intergenic
988390715 5:30625701-30625723 CTTTCTGTGAGGAGAGCAGCAGG - Intergenic
992308006 5:75463666-75463688 CTTGCTGTGCTGTGAGCAGCAGG - Intronic
995544156 5:113213660-113213682 TTTTCAGTACTGAGAGTGGTGGG + Intronic
996658272 5:125967526-125967548 CTTTCTGTGTAGTGAGCAGTAGG - Intergenic
996661438 5:126008419-126008441 GTTTCTTTGCTTAGAGAAGTTGG - Intergenic
996727086 5:126681939-126681961 CTTTATAGGCTGAGAGGAGTGGG + Intergenic
997356450 5:133265886-133265908 TTTGCTGTGCTGAGTGTGGTTGG + Intronic
998102889 5:139449003-139449025 CTTTCTGGCCTGAAAGTAGGAGG + Intronic
998863258 5:146466913-146466935 TTTCCTGTGCTGAGTTTAGTAGG + Intronic
999013576 5:148070987-148071009 CTTTCTGAGCTGCAAGGAGTTGG - Intronic
999247807 5:150164607-150164629 CTTTCTGAGCTGAGAGAACTGGG - Intergenic
1000722680 5:164727935-164727957 CTTTCTGTGCAGCAAGTAGCAGG - Intergenic
1002616345 5:180458851-180458873 CTCTCTGTGCGGTGAGCAGTGGG + Intergenic
1003200044 6:3951000-3951022 CTTTCTGTGCTGTGAGCAGCAGG + Intergenic
1003386532 6:5672874-5672896 CTTTGAGTGGTGAGAGTAATGGG + Intronic
1003454186 6:6265755-6265777 CTTTCTGTTCTTAAAGTAGGGGG + Intronic
1004198094 6:13523877-13523899 CCTTCTGTTCTGAGAGGTGTGGG + Intergenic
1004341101 6:14808047-14808069 CTTTCTGTGCGGCGAGCAGCAGG - Intergenic
1004567583 6:16813245-16813267 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1004688752 6:17973879-17973901 CTTTCTGGTTTGAGAGTTGTGGG - Intronic
1005924290 6:30429370-30429392 CCTTCTGTGTTGATAGTTGTTGG - Intergenic
1009877448 6:69522475-69522497 TTTTCTGTGCAGAAACTAGTTGG - Intergenic
1010064138 6:71660894-71660916 CTTTCTGTGCTGTGAGCAGCAGG + Intergenic
1011030622 6:82918995-82919017 CCTCCTGTGCAGAGAGTAGCAGG + Intronic
1011929179 6:92688770-92688792 CTTTCTGTGCAGCCAGTAGCAGG + Intergenic
1012368804 6:98477623-98477645 CTTTCTGTGCGGTGAGCAGCAGG + Intergenic
1012978051 6:105801167-105801189 TTTTTTGGCCTGAGAGTAGTTGG - Intergenic
1013492025 6:110657156-110657178 CACTCTGTGCGGAGAGTAGCAGG + Intronic
1013755100 6:113452119-113452141 CTTTCTGTGCGGTGAGCAGCAGG + Intergenic
1014495065 6:122111280-122111302 CTTCCTGTGCTGTGAGCAGCAGG + Intergenic
1014960241 6:127674443-127674465 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1019963963 7:4484003-4484025 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1021141870 7:17035704-17035726 CTTTCTGCTCTTAGTGTAGTAGG + Intergenic
1023207734 7:37769336-37769358 TTTTCTGTACTGGGAGGAGTAGG + Intronic
1023605809 7:41929710-41929732 CTTTCTGTGCAGTGAGCAATGGG - Intergenic
1024670359 7:51588572-51588594 CTTTCTGTGCAGCGAGCAATGGG + Intergenic
1024756053 7:52532651-52532673 CTTTCTGTGAGGTGAGTAGCAGG + Intergenic
1024792270 7:52980052-52980074 CAATCTGTTCTGAGAGTAGCAGG + Intergenic
1024968694 7:55049415-55049437 CTTTCACTGCTGAGTGCAGTGGG - Intronic
1026440695 7:70441210-70441232 CTCTCTGTGCTGTTAGCAGTAGG + Intronic
1027779222 7:82502181-82502203 CTTTCTGTGCCGTGAGCAGCAGG - Intergenic
1028480654 7:91301146-91301168 GCTTCTGTGCTGAGACTAGATGG - Intergenic
1028740904 7:94273961-94273983 CTTTCTGTGTGGAGAGCAGGAGG - Intergenic
1029369115 7:100136527-100136549 CTTTCTGGGCTGGGCGTGGTGGG - Intergenic
1030006404 7:105124819-105124841 TTTTTTGTGATGAGTGTAGTTGG - Intronic
1032463447 7:132128456-132128478 CTTTCTATGCTGAGAGCTGGTGG - Exonic
1033537884 7:142328802-142328824 CTTTATGTGCAGAGAGGAGACGG - Intergenic
1033551401 7:142451464-142451486 CTTTATGTGCAGAGAGGAGACGG - Intergenic
1033553666 7:142470029-142470051 CTTTATGTGCAGAGAGGAGATGG - Intergenic
1033573507 7:142657229-142657251 CTTTCTGTGTAGAGAGCAGGTGG - Intergenic
1034480808 7:151319317-151319339 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1034534351 7:151717769-151717791 CTTGGTGTGCTGAAAATAGTGGG + Intronic
1037527920 8:19745752-19745774 CTTTCTGTGCTGTGAGCAGCAGG - Intronic
1037973668 8:23193155-23193177 CTTTCTGTGCAGCGAGCAGCGGG + Intronic
1038211166 8:25520379-25520401 CTTTTAGTGCAGTGAGTAGTAGG - Intergenic
1038662142 8:29506597-29506619 CTTTCTGTGCAGTGAGCAATAGG + Intergenic
1038662604 8:29510238-29510260 CTTTCTGTGCAGTGAGCAATAGG + Intergenic
1039269719 8:35867742-35867764 ATTTCTGTGCAGAGAGCAGCAGG - Intergenic
1040650494 8:49443592-49443614 CTTTCTGTGCCGAGAGCAGCAGG - Intergenic
1040650502 8:49443692-49443714 CTTTCTGTGCCGAGAGCAGCAGG - Intergenic
1040659205 8:49549592-49549614 CTTTCTGTGCAGGGAGCAGCAGG - Intronic
1040659435 8:49553007-49553029 CTTTCTGTGCGGAGAGCAGCAGG + Intronic
1040794623 8:51275205-51275227 CTTTCTGTGCGGTGAGCAGCAGG + Intergenic
1040833970 8:51711906-51711928 CTTTCTGTGCTGCAAGCAGCAGG - Intronic
1042163421 8:65921447-65921469 CTGTGCGTGCTCAGAGTAGTTGG + Intergenic
1042816754 8:72886555-72886577 CTTTCTGAGCAGAGTGTAGATGG - Intronic
1042852711 8:73232411-73232433 CTTTCTGTGTGGCGAGTAGCAGG + Intergenic
1042953338 8:74223003-74223025 ATTTCTGTGCTTAGAAGAGTTGG - Intergenic
1043008856 8:74856712-74856734 CTTTCTATGCTGAGAGCAGCAGG - Intergenic
1043806342 8:84676701-84676723 CTTTCTGTGCTTGGAGTTATGGG + Intronic
1044274578 8:90285150-90285172 CATTCTGTGCTGAGAGCAGCAGG + Intergenic
1044449268 8:92314525-92314547 CATTCTTTGCAGAGAGTAGAGGG - Intergenic
1046277277 8:111980548-111980570 CTTTCTGTGCAGCAAGCAGTAGG - Intergenic
1047080832 8:121458524-121458546 CTTTCTGTGCAGAGAGCAGCAGG - Intergenic
1047670704 8:127143082-127143104 CATTCTGTGCTGTGAGCAGCAGG - Intergenic
1048385587 8:133909630-133909652 CTTGCTGTGTGGAGAGTAATGGG + Intergenic
1048643956 8:136396792-136396814 CTTGCTGTGCTGCAAGGAGTGGG - Intergenic
1049255173 8:141609948-141609970 CGTTCTGGGCTGAGAGGGGTGGG - Intergenic
1049376358 8:142291202-142291224 CTTTCTGAGATGAGGGTGGTGGG - Intronic
1050793751 9:9509710-9509732 CTTTCTGTGCAGTGAGTAGCAGG + Intronic
1052424776 9:28290478-28290500 CTTTCTGTGCAGCGAGCAGAAGG - Intronic
1052561764 9:30092180-30092202 CTTTCTGTGCAGTGAGCAGTAGG + Intergenic
1052886114 9:33649629-33649651 CTTTCTGTGTAGAGAGCAGGTGG - Intergenic
1053527623 9:38845785-38845807 CTGACTGTCCTGAGTGTAGTAGG - Intergenic
1053551397 9:39082867-39082889 CTTGCTGTGCCATGAGTAGTAGG + Intronic
1054199849 9:62070214-62070236 CTGACTGTCCTGAGTGTAGTAGG - Intergenic
1054638507 9:67518143-67518165 CTGACTGTCCTGAGTGTAGTAGG + Intergenic
1055059059 9:72050025-72050047 CTTTCTGTGCGGTCAGTAGCAGG + Intergenic
1055189866 9:73504926-73504948 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1056627054 9:88262564-88262586 CTTTCTGTGCTGAGAGCAGCAGG - Intergenic
1057194233 9:93107866-93107888 CTTTCTGGGCTGGGAGAAGCTGG + Intronic
1057395787 9:94678851-94678873 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1057762766 9:97889997-97890019 CTTTATCTTCTGAGAGTAATGGG - Intergenic
1061429823 9:130523912-130523934 CTTTCAGAGCTCAGAGTAGGGGG - Intergenic
1061545936 9:131304236-131304258 CTTTCTGTGCCGAGAGAGGAAGG - Intronic
1062211803 9:135368733-135368755 CTTTCTGTGCAGAGAGCCGCAGG + Intergenic
1203670760 Un_KI270755v1:9184-9206 CTTTCTGTGCAGTGAGCAGCAGG - Intergenic
1185699352 X:2218788-2218810 CTTTCTGCACTGAGAGTCCTGGG + Intergenic
1186048456 X:5562774-5562796 CTTTCTGTGTGGTGAGCAGTAGG + Intergenic
1186184494 X:7007027-7007049 CTTTCTGTGCAGTGAGCAGTGGG - Intergenic
1186344261 X:8675333-8675355 CTTTCTCTGCTGAGCGTGGCAGG - Intronic
1186523024 X:10222350-10222372 CTTTATGGGCTGGGAGTAGGAGG + Intronic
1189407611 X:40739170-40739192 CTTTCTGTGCAGGGAGCAATGGG + Intergenic
1189699409 X:43701630-43701652 CTTTCTGTGCTGCCAGTGGGAGG - Intronic
1190273700 X:48886399-48886421 CTTTGTTTGATGAGAGGAGTAGG - Intergenic
1190683608 X:52851207-52851229 CTGTCTGTGCTGGGAAGAGTGGG - Intergenic
1192087780 X:68117996-68118018 CTTGTTGTGATGAGAATAGTGGG - Intronic
1192846575 X:74912045-74912067 CTCTCTTTGCTTAGATTAGTGGG - Intronic
1193297538 X:79850700-79850722 CCTTCCATGCTGAGAGGAGTAGG - Intergenic
1194671787 X:96742390-96742412 CTTTCTGTGCTAAGAATAGAGGG - Intronic
1196294103 X:113979196-113979218 CTTTCTGTGCAGCGAGCAGCAGG + Intergenic
1196665109 X:118307895-118307917 CTTTCTGTGCGGTGAGCAGTAGG - Intergenic
1196872386 X:120125317-120125339 CTTTCTGTGCAGTGAGCAGCAGG + Intergenic
1197401507 X:125997374-125997396 CTTTCTGAGAAGAAAGTAGTTGG + Intergenic
1199141500 X:144319117-144319139 ATTTCTGTGCTGAGATTTCTTGG - Intergenic
1199184334 X:144897579-144897601 CTTTCCGTGCAGTGAGTAGCAGG + Intergenic
1200091544 X:153638390-153638412 CTTTCGGTGCTGGGAGGAGATGG + Intergenic
1202390486 Y:24365123-24365145 CTTTCTGTGCAAAGAGCAATAGG - Intergenic
1202480298 Y:25304993-25305015 CTTTCTGTGCAAAGAGCAATAGG + Intergenic