ID: 964743271

View in Genome Browser
Species Human (GRCh38)
Location 3:159988885-159988907
Sequence CGGCTGCGGCCGGGCACCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 286}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964743261_964743271 8 Left 964743261 3:159988854-159988876 CCGAGCTGGAGGCGGCGGGGCCG 0: 1
1: 0
2: 4
3: 38
4: 283
Right 964743271 3:159988885-159988907 CGGCTGCGGCCGGGCACCCCGGG 0: 1
1: 1
2: 1
3: 24
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964743271 Original CRISPR CGGCTGCGGCCGGGCACCCC GGG Exonic
900162814 1:1232376-1232398 CGGCCGAGCCCGGGGACCCCAGG + Exonic
900353465 1:2248256-2248278 AGGCTGAGTCCGGGCAGCCCCGG - Intronic
900474326 1:2869169-2869191 CACCTGCAGCCGGGCACCCCAGG - Intergenic
900801014 1:4737166-4737188 GGGCTGTGGATGGGCACCCCTGG + Intronic
901028519 1:6292254-6292276 CGGCTGTGGCCGGGGCCTCCTGG - Intronic
902169538 1:14598917-14598939 GGCGCGCGGCCGGGCACCCCCGG - Exonic
902585668 1:17437788-17437810 CCGCTGCGCCCGGGCGCCGCGGG - Intronic
902690536 1:18107956-18107978 CCGCCGCGGCCAGGCAGCCCGGG - Exonic
903233759 1:21937001-21937023 CGGCGCCCGCCGGGGACCCCGGG - Intronic
903339913 1:22647331-22647353 CCCATGGGGCCGGGCACCCCTGG - Exonic
904001579 1:27341930-27341952 CGGCTGCGGGGGCGCACCCCCGG + Intergenic
904068494 1:27773602-27773624 CAGCTGGGGCCGGGGACCCTCGG - Intronic
904612976 1:31735414-31735436 GGGCTGCGGCTGAGCACTCCGGG + Intronic
904751283 1:32742410-32742432 CGGCTGGGGCAGGGATCCCCTGG + Intronic
905629750 1:39511977-39511999 CTGGTGAGGCCGGGCACCCAGGG - Intronic
905668009 1:39774213-39774235 CTGGTGAGGCCGGGCACCCAGGG + Intronic
905912063 1:41662080-41662102 CCGCCGCGGCCTGGCAGCCCAGG - Intronic
907540970 1:55215234-55215256 CGGCTGCTGCGGAGCACCCGGGG - Intergenic
914293627 1:146298105-146298127 TGGCGGCGGCCGGGCCCCCACGG + Intergenic
914554671 1:148748888-148748910 TGGCGGCGGCCGGGCCCCCACGG + Intergenic
915213333 1:154325575-154325597 CAGCTGCGGCCCCGCTCCCCCGG - Intronic
915340354 1:155173906-155173928 CGGCTGCGGCTGCGAACCCCGGG - Intronic
920511874 1:206557547-206557569 CGGCCTCGGCCGGGAACTCCGGG + Intronic
922226833 1:223652769-223652791 CTGCAGCGGCTGGGCTCCCCGGG + Intronic
1062799410 10:368393-368415 CAGCTGTGGCCAGGCCCCCCTGG - Intronic
1063123383 10:3120289-3120311 CGGGTGCTCACGGGCACCCCTGG - Intronic
1063546299 10:6985500-6985522 CATCTGCGGCCGGGCAACCAAGG - Intergenic
1066180441 10:32957432-32957454 CGGTCCCTGCCGGGCACCCCGGG - Intronic
1067090228 10:43262674-43262696 CGGCTGCTGCAGAGCAGCCCCGG + Intronic
1067561892 10:47310170-47310192 GGGCTGGGCCGGGGCACCCCCGG - Exonic
1069769533 10:70888502-70888524 CGATCGCGGCCGCGCACCCCTGG + Intronic
1070773123 10:79094207-79094229 CGGCTGCAGCCGGACTCACCCGG - Intronic
1071676386 10:87659724-87659746 CGGCGGCGGCCGGGTCCCCAAGG + Exonic
1073156827 10:101354117-101354139 TGGCTGCGGCCTGGCACCAAAGG + Exonic
1074056075 10:109923628-109923650 GCGCTGCGGCCGCGAACCCCAGG - Intergenic
1076722043 10:132397026-132397048 CGGCGGCGGGCGGGGTCCCCGGG + Intergenic
1076947922 10:133664770-133664792 GGGCTGGGGCCGGGGTCCCCAGG + Intergenic
1076948912 10:133668080-133668102 GGGCTGGGGCCGGGGTCCCCAGG + Exonic
1076949896 10:133671379-133671401 GGGCTGGGGCCGGGGTCCCCAGG + Intronic
1076950880 10:133674678-133674700 GGGCTGGGGCCGGGGTCCCCAGG + Intergenic
1076951870 10:133677988-133678010 GGGCTGGGGCCGGGGTCCCCAGG + Intergenic
1076952859 10:133681298-133681320 GGGCTGGGGCCGGGGTCCCCAGG + Intergenic
1076953843 10:133684597-133684619 GGGCTGGGGCCGGGGTCCCCAGG + Intergenic
1076954827 10:133740949-133740971 GGGCTGGGGCCGGGGTCCCCAGG + Intergenic
1076955816 10:133744259-133744281 GGGCTGGGGCCGGGGTCCCCAGG + Intergenic
1076956806 10:133747569-133747591 GGGCTGGGGCCGGGGTCCCCAGG + Intergenic
1076957793 10:133750878-133750900 GGGCTGGGGCCGGGGTCCCCAGG + Intergenic
1076958778 10:133754177-133754199 GGGCTGGGGCCGGGGTCCCCAGG + Intergenic
1076959767 10:133757487-133757509 GGGCTGGGGCCGGGGTCCCCAGG + Intergenic
1076960751 10:133760786-133760808 GGGCTGGGGCCGGGGTCCCCAGG + Intergenic
1077026403 11:441843-441865 GGGCTGGGGCCGGGGGCCCCAGG + Intronic
1077049743 11:561272-561294 CGGCAGCGGCGGGGCTCCCCGGG + Exonic
1077327016 11:1968331-1968353 AGCCTGCGGCGGGGGACCCCAGG - Intronic
1077474234 11:2778858-2778880 CGGCTGCAGCCGGGCAGGCGGGG + Intronic
1079339193 11:19598047-19598069 TGGCTGGGGCCTGGCCCCCCAGG - Intronic
1080606600 11:33869467-33869489 CGGCGGCGCCCGAGCACCCGAGG - Exonic
1081528501 11:43942825-43942847 CCGCTGCGCCGGGGCCCCCCGGG - Exonic
1081831504 11:46119963-46119985 CGGCGGCCGCGGGGCGCCCCCGG - Intronic
1081861014 11:46333320-46333342 TGGCGGCGGCCGGGCAGCCGAGG + Intronic
1081870804 11:46381776-46381798 CGGCCGCGGCCGGGCGGACCAGG - Intronic
1083184371 11:61008670-61008692 GGGCTGCGGCTGGGCAGTCCAGG + Exonic
1083344350 11:61979056-61979078 GGGGTGCGGTGGGGCACCCCAGG - Intergenic
1083635458 11:64118303-64118325 GGGCTGAGGCGGGGCAGCCCGGG - Exonic
1084273482 11:68040726-68040748 CGGCTGCTGCCGGGCGGCCCGGG + Intronic
1084444700 11:69196849-69196871 CTGCTCCGGCCGGGCCACCCTGG - Intergenic
1090189695 11:124759904-124759926 CCGCTGAGGCCGGGCACGCCTGG + Intronic
1091248914 11:134125098-134125120 TGGCGGCGGCCGTGCACCTCGGG - Intronic
1091263691 11:134253853-134253875 CTACTCCGGCCGGTCACCCCCGG + Intronic
1091263790 11:134254081-134254103 CTCCTGCGGCCGGTCACCCTCGG + Intronic
1202809998 11_KI270721v1_random:23511-23533 AGCCTGCGGCGGGGGACCCCAGG - Intergenic
1091718502 12:2795817-2795839 CGGCGTCGGCAGGGGACCCCGGG - Intronic
1094843030 12:34349870-34349892 CGGCTGTGGGCGGCTACCCCAGG + Intergenic
1096241402 12:49961990-49962012 CAGCTGCCGCCGGGCCCCCGCGG + Exonic
1096489768 12:52007133-52007155 CGGCTGCGGCAGGGGGTCCCGGG - Exonic
1096839362 12:54371012-54371034 CGGCTGGGGCCTCCCACCCCGGG - Exonic
1100309176 12:93378258-93378280 TGGCGGCGGCCGGGCCCCCACGG + Exonic
1100777771 12:97991220-97991242 CAGATGCGGCAGTGCACCCCTGG - Intergenic
1102197319 12:111034561-111034583 GGGCTGCTGGCGGGAACCCCCGG + Intronic
1102203623 12:111075184-111075206 CAGCTGCTGCCAGGCACCCCTGG + Intronic
1103309150 12:119990119-119990141 CGGCTGCGGTCCGGCCCCCTCGG - Exonic
1103339488 12:120213898-120213920 CGGCTGCGCCCGGGCCATCCTGG - Exonic
1103363875 12:120368949-120368971 CGGGTCCGGCCGGGCCTCCCCGG - Intronic
1103690987 12:122774452-122774474 GGGCTGCGGCCCGGAAACCCTGG + Exonic
1105270918 13:18875031-18875053 CAGCTGCGGGCGGGCACTGCTGG + Intergenic
1105804536 13:23945654-23945676 TGGATGGGGCCGGGCACCCTTGG - Intergenic
1106036859 13:26051560-26051582 TGGCTCCGGCCGGGCCGCCCGGG + Intergenic
1108312791 13:49212256-49212278 CGGGTCCGGCCGGGCTCCACTGG + Intergenic
1108676019 13:52738921-52738943 CGGCTGCCGGCGGGCCCCTCGGG - Intronic
1110450678 13:75635773-75635795 CTGCGGCGGCCGGGCCCTCCCGG - Intronic
1110450818 13:75636190-75636212 CGGCCGCGGCCGGGAGCCCGGGG + Intronic
1112436034 13:99391957-99391979 GGGCTGGGGCAGGGCACCCCAGG + Intergenic
1113490004 13:110684072-110684094 CGGCTGCAGCCGGGCAGCCTTGG - Intronic
1113513648 13:110874599-110874621 GGGCTGCGGCAGGGCACGGCTGG - Intergenic
1114454671 14:22847003-22847025 AGGCTGGGGCCGGGCAGGCCAGG + Exonic
1121342699 14:93115030-93115052 CGCCGGCGCCCGGGGACCCCCGG - Intronic
1121739363 14:96240613-96240635 CTGCTGCGGCCAGGTTCCCCAGG - Exonic
1122227233 14:100286834-100286856 CAGCTGGGGCCAGGCAACCCTGG - Intergenic
1122235840 14:100330229-100330251 CGGCCGAGGACGGCCACCCCAGG - Exonic
1122517624 14:102319816-102319838 CGGCGGCGGCCCGGCTCCTCCGG + Exonic
1122689630 14:103525993-103526015 CGGCTCCGGCCTGGCGCCGCTGG + Intergenic
1122838352 14:104442413-104442435 CGGCTTCTCCCGGCCACCCCGGG + Intergenic
1122961004 14:105093594-105093616 CGCCTGCGGCGGCGCAGCCCAGG - Intergenic
1202859419 14_GL000225v1_random:72278-72300 CGGCTGGGGCCGGGGTACCCAGG - Intergenic
1202860582 14_GL000225v1_random:79109-79131 GGGCTGGGGCCGGGGTCCCCAGG - Intergenic
1202922069 14_KI270723v1_random:35597-35619 GGGCTGGGGCCGGGGTCCCCAGG + Intergenic
1202922861 14_KI270724v1_random:2016-2038 GGGCTGGGGCCGGGGTCCCCAGG - Intergenic
1124469318 15:29968952-29968974 CGGGAGCGGCCGGGCACGCACGG - Intergenic
1127661038 15:61100404-61100426 CCGCTCAGGCCGGGCACCGCTGG - Intronic
1130931030 15:88428193-88428215 AGGCCGGGGCCGGGCAGCCCTGG + Intergenic
1131055288 15:89371300-89371322 CGGCCGCGGCCGGACCTCCCGGG + Intergenic
1131515401 15:93073321-93073343 GCGCTGCGGCCGGGCAGCCTGGG - Intronic
1132559486 16:586915-586937 CGGCGGCTGCTGGGCTCCCCGGG + Intergenic
1132669833 16:1098046-1098068 CGGCTGCTGCCGGGTGCCCTGGG + Intergenic
1132721740 16:1319947-1319969 CGGCTGCGGCCGTGTCCCCAAGG + Intronic
1132862366 16:2077962-2077984 AGGCTGCTGCCCGGCACGCCTGG - Intronic
1133062548 16:3184011-3184033 CGTCTGCGTCCCGGGACCCCGGG + Intergenic
1133063112 16:3188265-3188287 CGTCTGCGTCCCGGGACCCCGGG - Intergenic
1135040602 16:19114424-19114446 CGGCGGTGGCCGAGCAGCCCAGG - Exonic
1139527396 16:67525342-67525364 CGGCTGTGCCCGGGCCACCCTGG - Intronic
1142275038 16:89113918-89113940 AGGCTGCGGCCAGGCACATCCGG - Intronic
1142287663 16:89177968-89177990 AAGGTGGGGCCGGGCACCCCAGG + Intronic
1142296969 16:89230492-89230514 CTGCTGCGACCCGGCACTCCTGG + Exonic
1203089230 16_KI270728v1_random:1202317-1202339 CGGATGCTGCAGGGCAGCCCTGG - Intergenic
1142850944 17:2704485-2704507 CGGCGGCGGCCGAGCCACCCAGG - Exonic
1143010148 17:3861798-3861820 CCGCTGGGGCCGGGCAGGCCTGG - Intronic
1143095392 17:4476062-4476084 GGGCTGCGCCCGTCCACCCCAGG + Intronic
1143150770 17:4806864-4806886 AGGCAGCGGCCGGGCACGCTGGG + Intergenic
1144775139 17:17781555-17781577 CCCCTGCGGCCAAGCACCCCAGG - Intronic
1145250694 17:21295495-21295517 CGGCTGCACCTGGGCAGCCCTGG + Intronic
1146058305 17:29591924-29591946 CCGCTGGGGCCTGGCACCACAGG + Intronic
1146492314 17:33291999-33292021 TGGCGGCTGCCGGGCAGCCCGGG - Exonic
1147187767 17:38722027-38722049 CGGGTTGGGCCGGGCACCCGGGG + Exonic
1147994587 17:44353893-44353915 CGGCTGCGGCCCCGCCCCCGGGG + Exonic
1148105736 17:45117964-45117986 GGGCTGGGGCTGGGCATCCCAGG + Intronic
1148559434 17:48597473-48597495 CGGCTCTGGCCAGGCGCCCCAGG + Intronic
1149296389 17:55265641-55265663 CGGCCGCGGAGGGGGACCCCCGG - Intronic
1150802223 17:68291393-68291415 CGGCTGCAGCCGGTCTCCGCCGG + Intronic
1151240589 17:72754654-72754676 CGGCTGCGGCCCGGCACCCCTGG - Intronic
1151347548 17:73511460-73511482 CTGCTGCAGGCTGGCACCCCCGG - Intronic
1151499893 17:74481872-74481894 GGGCTGTGCCAGGGCACCCCTGG + Intronic
1151658151 17:75505143-75505165 CAGCTGCGGTCCGGCAACCCTGG + Intronic
1152105247 17:78324845-78324867 CGGCTGCAGCCGTGGACTCCGGG + Intergenic
1152587032 17:81193753-81193775 CGGCTGAGGCTGGGCCCCCAAGG + Intronic
1152654935 17:81514978-81515000 GGGCGGCGGCCGGGCAGCCTCGG + Intronic
1152924006 17:83079472-83079494 CGCGTCCGGCCGGGCGCCCCGGG + Intergenic
1153040878 18:812216-812238 TTGCTGCCGCCGGGCGCCCCGGG - Intronic
1154274701 18:12948512-12948534 GGGCTGCGGGCGGGAACCCAGGG + Intronic
1155075220 18:22348641-22348663 CGGCTCCGGCTGGGCGGCCCCGG + Intergenic
1157384167 18:47247863-47247885 CGCCTGCGCCCGCGCCCCCCAGG + Intronic
1157617714 18:48997049-48997071 CTGCTGCGGCCTGGCTGCCCTGG + Intergenic
1158435908 18:57435552-57435574 GGGCTGCGGGCGGGCTCGCCCGG - Intergenic
1158530556 18:58256279-58256301 CTGCCGCGGCCGGGCCGCCCTGG - Intronic
1159369914 18:67516723-67516745 CAGCTCCGGCCGCGCAGCCCGGG + Exonic
1161133926 19:2608600-2608622 TGGCTGCCACCGGACACCCCAGG + Intronic
1161229774 19:3168113-3168135 GGGCTGCTGCCGGCCAACCCTGG - Intergenic
1161288927 19:3482705-3482727 CCGCTGCGACCGGGCAGCTCAGG + Intergenic
1161393626 19:4033594-4033616 CGGCTCCGGCCGCCCTCCCCGGG - Intronic
1161664540 19:5567610-5567632 GGGCGGCGGCCGGGGACCCCTGG - Intergenic
1161722118 19:5908953-5908975 CTGCCGCCGCCGGCCACCCCTGG + Exonic
1162502249 19:11060486-11060508 GGGCTGAGGCCGGGCAGGCCAGG + Intronic
1163437768 19:17305541-17305563 CAGCTGCGCCCGGCCACCGCGGG + Intronic
1163443659 19:17334314-17334336 GGGCTGCGCCCTGCCACCCCCGG - Intronic
1163587039 19:18169680-18169702 AGGCTGGGGCCGCGCAGCCCAGG - Exonic
1163676886 19:18659861-18659883 AGGTTGCGGCCAGGCACCCTAGG - Intronic
1163780553 19:19245056-19245078 TGGGTGCGGCCGGGCACCCAGGG + Intronic
1165058644 19:33194466-33194488 CGGCCGCGGCGGGGCTCCCGGGG + Intronic
1166106726 19:40601324-40601346 CGGGTGCGGCCGGGCCCCTCGGG + Intronic
1166317886 19:41998899-41998921 CGGCCGCGGCCTGGCCCCGCCGG - Exonic
1166746280 19:45143364-45143386 CTGCCTCGGCCTGGCACCCCTGG - Intronic
1167056282 19:47113072-47113094 CGGCGGGGGCCGGGCAGCCGGGG - Intronic
1167314950 19:48757635-48757657 GGGCTGGGGCCTGGAACCCCGGG + Intronic
1167314964 19:48757671-48757693 AGGCTGGGGCCTGGAACCCCGGG + Intronic
1167314978 19:48757707-48757729 AGGCTGGGGCCTGGAACCCCGGG + Intronic
1167859269 19:52269963-52269985 CGGCTGCGGCGCTGCGCCCCAGG - Intronic
1168097425 19:54123684-54123706 GGGCTGGGGCTGGGCACACCAGG + Intronic
1168269124 19:55240156-55240178 GGGCTGGGGCTGGGCATCCCTGG - Intronic
925906669 2:8543959-8543981 CGCCTGCTCCCGGGCACCTCAGG + Intergenic
926027240 2:9555859-9555881 CGGCTGCCGCGCGGCATCCCGGG + Intergenic
926087566 2:10029608-10029630 CGGCTGAGGCTGCCCACCCCAGG + Intergenic
926727990 2:16013369-16013391 GGGCTGCGGCCGGTCTACCCGGG - Intergenic
927652237 2:24919879-24919901 CCCCTGCGGCCGGGCGCCCGCGG - Intergenic
929242435 2:39666200-39666222 CGGCTGCTCCCGGGCGGCCCGGG + Exonic
929313597 2:40452245-40452267 CCGCGGCTGCCGGGCGCCCCGGG + Intronic
933751127 2:85602610-85602632 CGGCGGCGGCGGGGCGCTCCGGG - Intronic
935660257 2:105460685-105460707 CAGCTGCAGACGGGCAGCCCTGG - Intergenic
937349174 2:121149565-121149587 CCGCTGAGGCCGGTCACTCCGGG + Intergenic
938339795 2:130527801-130527823 CGGATGCGCCCGCGCACCCTCGG + Exonic
938350041 2:130592949-130592971 CGGATGCGCCCGCGCACCCTCGG - Exonic
938934566 2:136117140-136117162 CGGCGGCGACCTGGCAGCCCAGG + Intronic
944676072 2:202034727-202034749 CGGCTGCGCCCCGGCGCCCGCGG - Exonic
946354863 2:219178294-219178316 CGGCGGCGGCCGCGCAGCCCTGG + Exonic
946921253 2:224584654-224584676 CGGCTGCGGCCGGGGCCCCTCGG - Intronic
947741797 2:232488025-232488047 GGGCTGCGGTCGGGGACTCCGGG + Intergenic
948560697 2:238849262-238849284 CGCCGACGGCCGGGGACCCCAGG - Intronic
948850386 2:240702687-240702709 CGGCTTCTGCAGGGCACCCCCGG - Intergenic
948953826 2:241272405-241272427 GGGCTTCGGTGGGGCACCCCTGG - Intronic
1170568474 20:17619910-17619932 AGGCTGCACCCGGGCACTCCTGG + Intronic
1171865300 20:30484638-30484660 CGGCTGCGGCCGAGTTCCCGTGG - Intergenic
1172028958 20:31968276-31968298 CGGCGGCGGCCGGGCCCCCGGGG + Exonic
1172320889 20:33994323-33994345 GGGCTGGGGCCGGGGACCCGGGG - Intronic
1173856094 20:46251527-46251549 GGGGCGCGGGCGGGCACCCCGGG - Exonic
1174430019 20:50460862-50460884 AGGCTGGGGCCAGGCACCCTGGG - Intergenic
1175539302 20:59738232-59738254 GGGCTGGGACCAGGCACCCCAGG - Intronic
1175699951 20:61129757-61129779 CGGCTGTGGCAGGGGTCCCCGGG - Intergenic
1175926577 20:62474313-62474335 CGGCTGCTGGCGCCCACCCCCGG - Intronic
1176178439 20:63739208-63739230 CGGCTAGGCCCGGGCGCCCCGGG - Intronic
1176214201 20:63940577-63940599 CGGCTGCCCCCAGGCACCTCGGG + Exonic
1176550086 21:8217179-8217201 CGGCGCCCGCCGGGCTCCCCGGG - Intergenic
1176569013 21:8400214-8400236 CGGCGCCCGCCGGGCTCCCCGGG - Intergenic
1176576927 21:8444449-8444471 CGGCGCCCGCCGGGCTCCCCGGG - Intergenic
1177187904 21:17818918-17818940 CGGTACCGGCCGGGCACCGCCGG + Intronic
1178914574 21:36699336-36699358 CGGCTGCGGCAAGGCCCCTCCGG - Exonic
1179822239 21:43943652-43943674 CGGCTGAGGCCTGGCAGGCCAGG - Intronic
1180077703 21:45471529-45471551 CAGCTGCGGCCGGGGGTCCCAGG - Intronic
1180188703 21:46152712-46152734 CGCCTGCGGCCGTGCAGGCCCGG - Intronic
1180414206 22:12693744-12693766 GGGCTGGGGCCGGGGTCCCCAGG - Intergenic
1181902801 22:26169732-26169754 GCGCTGCCGCCGGGCTCCCCAGG - Exonic
1184222769 22:43111211-43111233 CGGCCGCGGCCGCACAGCCCCGG + Intronic
1184288889 22:43487676-43487698 AGCCTGTGGCCTGGCACCCCAGG + Intronic
1184474296 22:44712225-44712247 CCGGTGCAGTCGGGCACCCCAGG + Intronic
1184737902 22:46409925-46409947 CGTCTGGCGCCGGGGACCCCGGG - Intronic
1184799738 22:46752216-46752238 CGGCTGAGGCTGGGCTCCCTTGG + Intergenic
1185227061 22:49659270-49659292 CGGCTGCAGCCCGGTGCCCCGGG - Intergenic
1185387847 22:50544536-50544558 CGGTGGCGGCAGCGCACCCCCGG - Intergenic
1203254976 22_KI270733v1_random:133505-133527 CGGCGCCCGCCGGGCTCCCCGGG - Intergenic
1203263032 22_KI270733v1_random:178584-178606 CGGCGCCCGCCGGGCTCCCCGGG - Intergenic
950119284 3:10470999-10471021 GGGCTGCCGCAGGGCCCCCCAGG - Intronic
950448044 3:13049325-13049347 TGGCTGTGGCAGGGCAGCCCTGG - Intronic
952506884 3:34015528-34015550 CAGCTGGGGCAGAGCACCCCCGG + Intergenic
954335140 3:49911887-49911909 AGGCAGCGGCGGGGGACCCCTGG + Exonic
954763884 3:52897227-52897249 CAGCCGCGGCCCGGCCCCCCTGG - Intronic
955368743 3:58332966-58332988 CGGCGGCGGCCGGGCGTCCCGGG + Exonic
961754353 3:129119218-129119240 CTGCTGCGGCAGCGGACCCCAGG + Intronic
964743234 3:159988760-159988782 CGGCTAAGGCCGGGGACCCAGGG + Exonic
964743271 3:159988885-159988907 CGGCTGCGGCCGGGCACCCCGGG + Exonic
967166324 3:186783230-186783252 CGGCTCCGGCGCGGCTCCCCCGG + Intronic
968520306 4:1032056-1032078 GGGCTGCCGCAGGGCAGCCCTGG + Intergenic
968654073 4:1771173-1771195 AGTCTGAGGCCGGGCACCCCTGG - Intergenic
969721110 4:8893473-8893495 CTGCCGCGGCCCGGCGCCCCGGG - Intergenic
981889331 4:149716601-149716623 CGGCTGCAGCCGGGCAGGCTTGG - Intergenic
983937105 4:173509653-173509675 CGGCTGCAGCCGCGCGGCCCAGG - Intergenic
985446008 4:190021714-190021736 GGGCTGGGGCCGGGGTCCCCAGG - Intergenic
985451376 4:190065571-190065593 GGGCTGGGGCCGGGGTCCCCAGG + Intergenic
985452366 4:190068864-190068886 GGGCTGGGGCCGGGGTCCCCAGG + Intergenic
985453351 4:190072161-190072183 GGGCTGGGGCCGGGGTCCCCAGG + Exonic
985454341 4:190075454-190075476 GGGCTGGGGCCGGGGTCCCCAGG + Exonic
985455329 4:190078747-190078769 GGGCTGGGGCCGGGGTCCCCAGG + Exonic
985456317 4:190082047-190082069 GGGCTGGGGCCGGGGTCCCCAGG + Exonic
985457301 4:190085341-190085363 GGGCTGGGGCCGGGGTCCCCAGG + Intergenic
985458288 4:190088634-190088656 GGGCTGGGGCCGGGGTCCCCAGG + Exonic
985459277 4:190091934-190091956 GGGCTGGGGCCGGGGTCCCCAGG + Exonic
985463529 4:190174703-190174725 GGGCTGGGGCCGGGGTCCCCAGG + Exonic
985650205 5:1104057-1104079 GGGCTGCGGTCGGGGACCCTTGG + Intronic
985671410 5:1208826-1208848 CGGCTGCGGCGGGGCAGCCTGGG + Exonic
985692814 5:1323105-1323127 CAGCAGAGGCCGGGCACTCCAGG + Intronic
985692851 5:1323220-1323242 CAGCAGAGGCCGGGCACTCCAGG + Intronic
991676614 5:69094478-69094500 AGGCTGCCTCCGGGCTCCCCGGG + Intronic
992487435 5:77210402-77210424 CGGCTGCGGCCGCGGAGCCGGGG + Intergenic
992939942 5:81751506-81751528 CGGCTCCGGCCGGAGACTCCAGG - Intronic
999727015 5:154446016-154446038 GGGCGGCGGCCGGGCGGCCCAGG + Exonic
999743414 5:154574064-154574086 CGGCTTCGGCCCAGCATCCCCGG + Intergenic
1000279935 5:159773573-159773595 TGGCTGCTGCCGCGCGCCCCGGG - Intergenic
1000319020 5:160119144-160119166 GGGCTGCGGGCGAGCTCCCCCGG + Exonic
1002715138 5:181222560-181222582 CGGCCGCGGCAGGGGTCCCCGGG - Intronic
1002784777 6:392617-392639 CGCCTGCGGCCGGGCGTTCCAGG - Intronic
1002895553 6:1378269-1378291 CAGCCGCCGCCGGGCACCGCGGG - Intergenic
1011734383 6:90296769-90296791 CAGCAGCGGCCGTGCACGCCCGG - Intronic
1013117809 6:107115552-107115574 GGGCGGCGGCCGCGCACCCACGG + Intergenic
1018668167 6:166158524-166158546 CGGCTGCTGCCTGGGAGCCCGGG + Exonic
1019764991 7:2843750-2843772 CCGCCGCGGGCGGGGACCCCTGG - Intronic
1023031296 7:36092518-36092540 CAGCTCCGGGCGGGCAGCCCTGG + Intergenic
1023287065 7:38631242-38631264 GGGCTGGGGCCGGGGACGCCAGG - Intronic
1023995697 7:45157810-45157832 CAGCTGCGGCCGGCCAGCCATGG + Exonic
1024579874 7:50793092-50793114 CGGCCGCGGCCGGGGACGCCGGG - Intronic
1025244784 7:57308844-57308866 CGGCTGGGGCCAGGCACCCTGGG + Intergenic
1026923762 7:74174616-74174638 CGGCGGCGGCTGGGCTCCCGGGG + Intronic
1026944374 7:74306578-74306600 AGGCTGCAGCCCGCCACCCCCGG + Intronic
1029708388 7:102287018-102287040 GGACCGCGGCCGGGCTCCCCGGG - Intronic
1033220495 7:139523950-139523972 CGGCGGCGGCCGGGCCCGCGAGG - Exonic
1034174824 7:149091482-149091504 AGGCTGCGGTCGGGCACCCCGGG + Intergenic
1037957098 8:23068630-23068652 CGCCTGCGGCCGGGCATGTCCGG - Intronic
1037969731 8:23163665-23163687 CGCCTGCGGCCGGGCATGTCTGG - Intronic
1038596405 8:28890358-28890380 CTGCTGCCGCCGGGCGTCCCTGG - Intergenic
1039554781 8:38468054-38468076 CGGCTCCGGCCCGCCGCCCCCGG + Intronic
1040423405 8:47260953-47260975 CGGCTGCCGCGGGGCATCTCCGG - Exonic
1040843452 8:51809265-51809287 CGGCTGGGGCAGGGCAACCCTGG + Exonic
1043502984 8:80874408-80874430 CGGCTGCGCCCGCGCGCTCCGGG + Intronic
1045003207 8:97896068-97896090 CTGCTGCAGCCGGTCACACCTGG + Intronic
1048334413 8:133492062-133492084 CAGCTGAGGCCTGGCAGCCCTGG + Intronic
1049344180 8:142129614-142129636 CGGCTGGGGCCGGGCTCCTGTGG + Intergenic
1049468692 8:142765382-142765404 AGGGTGGGGCCGGGCAGCCCTGG + Intronic
1049542509 8:143214971-143214993 AGGCCGAGGCCGGGCCCCCCAGG - Intergenic
1049628121 8:143635885-143635907 CCGCTCCTGCCGGACACCCCTGG + Intergenic
1049815235 8:144596153-144596175 CGGCTGAGGCCTGGCCACCCCGG + Intronic
1052824768 9:33166912-33166934 AGGCGGCGGCCGGGCCCCTCCGG + Exonic
1056634524 9:88320590-88320612 GGGCTGGGGGCGGGGACCCCTGG - Intergenic
1056732608 9:89178645-89178667 CAGCGGCGGCCGCGCAGCCCCGG + Exonic
1057220628 9:93256073-93256095 CTGATGTGCCCGGGCACCCCTGG + Intronic
1058053284 9:100427242-100427264 CGGCGGCGGCGGCGCGCCCCCGG - Intronic
1060400550 9:123346333-123346355 CGGCTGCTGGCGGGCCTCCCGGG + Intergenic
1061202090 9:129143776-129143798 CGGCTGCAGCTGGCCACCCCCGG + Intronic
1061516148 9:131091605-131091627 AGGCTGCAGCTGGGCTCCCCGGG + Exonic
1062470441 9:136701231-136701253 AGGCTGGGGCCGGGAACCTCAGG - Intergenic
1062567280 9:137168865-137168887 CGGCAGCGGCGGGGCTCCCCGGG + Exonic
1203471378 Un_GL000220v1:116651-116673 CGGCGCCCGCCGGGCTCCCCGGG - Intergenic
1203479199 Un_GL000220v1:160623-160645 CGGCGCCCGCCGGGCTCCCCGGG - Intergenic
1190024886 X:46913279-46913301 TGGGTGCGGCGAGGCACCCCGGG + Intronic
1197709298 X:129654461-129654483 CGGCTCGCGCCGGGCTCCCCGGG + Intronic
1199699480 X:150365002-150365024 CGGTGGCGGCCGGGAAGCCCCGG - Intronic
1200101995 X:153692869-153692891 AGGCTGCGCCCCGGCAGCCCTGG - Intronic
1200111563 X:153743408-153743430 CTGCTGCTGCCGGGCCCGCCAGG - Intronic
1200118827 X:153781021-153781043 AGGCCGCGGCCGGGCCCCACAGG + Exonic
1201175834 Y:11307846-11307868 GGGCTGGGGCCAGGGACCCCAGG + Intergenic