ID: 964746207

View in Genome Browser
Species Human (GRCh38)
Location 3:160014931-160014953
Sequence AGGTTCCCCCAAGAACAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964746207_964746213 22 Left 964746207 3:160014931-160014953 CCCTGTTGTTCTTGGGGGAACCT No data
Right 964746213 3:160014976-160014998 ATCAGCTATTCTAGCTTCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964746207 Original CRISPR AGGTTCCCCCAAGAACAACA GGG (reversed) Intergenic