ID: 964747301 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 3:160024377-160024399 |
| Sequence | ATGTATTCTAATAGTTCTTG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 536 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 54, 4: 480} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 964747301_964747303 | 20 | Left | 964747301 | 3:160024377-160024399 | CCTCAAGAACTATTAGAATACAT | 0: 1 1: 0 2: 1 3: 54 4: 480 |
||
| Right | 964747303 | 3:160024420-160024442 | GAAGATGCCCACTTCATATGCGG | 0: 1 1: 0 2: 1 3: 10 4: 102 |
||||
| 964747301_964747302 | -2 | Left | 964747301 | 3:160024377-160024399 | CCTCAAGAACTATTAGAATACAT | 0: 1 1: 0 2: 1 3: 54 4: 480 |
||
| Right | 964747302 | 3:160024398-160024420 | ATACATAAAACTTACTGACACGG | 0: 1 1: 0 2: 1 3: 12 4: 284 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 964747301 | Original CRISPR | ATGTATTCTAATAGTTCTTG AGG (reversed) | Intronic | ||