ID: 964747303

View in Genome Browser
Species Human (GRCh38)
Location 3:160024420-160024442
Sequence GAAGATGCCCACTTCATATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964747301_964747303 20 Left 964747301 3:160024377-160024399 CCTCAAGAACTATTAGAATACAT 0: 1
1: 0
2: 1
3: 54
4: 480
Right 964747303 3:160024420-160024442 GAAGATGCCCACTTCATATGCGG 0: 1
1: 0
2: 1
3: 10
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964747303 Original CRISPR GAAGATGCCCACTTCATATG CGG Intronic
903382312 1:22905858-22905880 GGAGTTGCCCAGTTCTTATGGGG + Intronic
904317968 1:29678028-29678050 AAAGATGACATCTTCATATGGGG - Intergenic
907624804 1:56019185-56019207 GAAGTTGACCCCTTCATTTGTGG + Intergenic
910155046 1:84207404-84207426 AAAGATGCCCAGGTCTTATGAGG + Intronic
910432344 1:87171378-87171400 GAAGTTGCCCATGGCATATGAGG - Intergenic
910565276 1:88636557-88636579 GATGATGCCCACTTCTATTGGGG + Intergenic
912434656 1:109652839-109652861 GAAGATGCTGACTTCAGAGGTGG + Intergenic
912467856 1:109886341-109886363 GAACATGCCCACCCCAGATGGGG - Intergenic
918492354 1:185094755-185094777 GAAAATGCCCACCTTATATAGGG - Intronic
919642172 1:200056287-200056309 GAACATGCCCACTTACTGTGGGG + Intronic
924386613 1:243504580-243504602 GAAGAAGCCCATATCACATGTGG - Exonic
1066483646 10:35822943-35822965 GAAGATGACCACTTGACTTGGGG + Intergenic
1070680643 10:78446544-78446566 GAAGAGACCCATTTCATATGTGG + Intergenic
1079077840 11:17394882-17394904 GAAGATGCCCCCTTGGCATGGGG + Intronic
1084778751 11:71395387-71395409 GGAGAAGCCCACCTCATCTGCGG - Intergenic
1086978654 11:93167834-93167856 AAAGACCCCTACTTCATATGTGG - Intronic
1087520543 11:99229102-99229124 CAAGTTGCTCACTTCATACGTGG - Intronic
1088099615 11:106141508-106141530 GAAGATGCCTAATGCATTTGAGG - Intergenic
1096110824 12:49028075-49028097 GAAGATCCCCAACTCCTATGAGG - Exonic
1107258365 13:38459102-38459124 GAAGCTGCCCACTACATCTTTGG + Intergenic
1108213156 13:48158533-48158555 GAAAATCCCCACTTCAGAGGAGG - Intergenic
1110791063 13:79587283-79587305 GAAAATGCTTGCTTCATATGAGG + Intergenic
1112383656 13:98917893-98917915 GGAGATGCCCCCTTTAAATGGGG + Intronic
1114830707 14:26138070-26138092 GAAGATGCTCTCTTCAACTGAGG + Intergenic
1115200380 14:30847510-30847532 GAAGGTGCCCTCTTCATATAGGG + Intergenic
1117507382 14:56416923-56416945 GAGGATGCCCAATGCAGATGGGG + Intergenic
1118065573 14:62186957-62186979 GAAGCTGCCCCTTTCAGATGTGG + Intergenic
1121876993 14:97462094-97462116 GAAGATTCACACTTCATACGTGG - Intergenic
1121962852 14:98277180-98277202 CAAGATGCCAGCTTCATGTGAGG + Intergenic
1123454527 15:20408087-20408109 GAAGCTGCCACCTTCTTATGTGG + Intergenic
1127187542 15:56494866-56494888 AAAGCTCCCCACTTCTTATGGGG + Intergenic
1131180861 15:90238771-90238793 AAAGATGACCACTTCTTTTGTGG - Intronic
1134311838 16:13082309-13082331 TATGATGCCCAGTTCATGTGGGG + Intronic
1139911417 16:70399629-70399651 GGAGATGCCCACTTAATCAGAGG + Exonic
1140730766 16:77853821-77853843 GAATATGCCTACTTCTTTTGGGG + Intronic
1146606001 17:34258234-34258256 GAAGCTGCCCCCTTAAAATGTGG - Intergenic
1147232474 17:39029382-39029404 GAAGGTGCACACTCCATAGGAGG - Intergenic
1150811088 17:68357754-68357776 GTAGCTGCCCCCTTCAGATGGGG - Intronic
1151413809 17:73948414-73948436 GGAGAAGCCCACATCATGTGTGG + Intergenic
1152453419 17:80398064-80398086 GAACTTGCCCACTCCATTTGAGG + Exonic
1157325382 18:46665154-46665176 GAAACTGCCCACTTCATATCTGG + Intergenic
1157345982 18:46833528-46833550 AAAAATGCCTACTTCATAAGAGG + Intronic
1159026312 18:63184937-63184959 CAAGATGCCCACTGCTTCTGGGG - Intronic
1164565700 19:29324362-29324384 GAAAATGCCCACTCCAGAGGTGG - Intergenic
1165598868 19:37035856-37035878 AAAGATTCCTACTTCATATCTGG + Intronic
1165708540 19:37993213-37993235 GATGACACCCACTTCACATGGGG + Intronic
1165771779 19:38384603-38384625 GAAGCTTCCCTATTCATATGGGG - Intronic
1168697300 19:58411171-58411193 GCAGATGCCCATTTCAGGTGAGG + Intronic
927765773 2:25806268-25806290 GAAGATGCCCTCTTCACCTCTGG + Intronic
928858718 2:35830091-35830113 GGGGATGTCCACTTCAGATGGGG + Intergenic
936471441 2:112802167-112802189 GAACATGCCCTCCTCAGATGAGG - Intergenic
938293798 2:130164215-130164237 AACGATGCCCACTTCTTATTTGG + Intronic
938557599 2:132439903-132439925 CAGCATGCCCACTTCCTATGGGG + Intronic
940590515 2:155718960-155718982 GAAGATTCCTACTGCAGATGTGG + Intergenic
941127670 2:161605316-161605338 GAAGGTGCCCACAGCATATAAGG + Intronic
943676580 2:190721623-190721645 CAAGATCCCCATTTCAGATGGGG + Intergenic
1170657370 20:18301655-18301677 GAATTTGCCCACTTCATCTAGGG - Intronic
1172177950 20:32984026-32984048 GAAGTTTCCCATTTCATAGGTGG + Intronic
952091364 3:29890623-29890645 GAAAATGCTCACGTCATATTAGG + Intronic
960858410 3:122126582-122126604 GAGGATGGCAACTTCATGTGAGG + Intergenic
962146283 3:132843275-132843297 GAAGAGGCTCAATTCATTTGAGG - Intergenic
963206542 3:142642011-142642033 GCAGCTTCCCACTTCATATCTGG + Intronic
963857867 3:150274294-150274316 GTAGATGCCCAGGCCATATGTGG - Intergenic
964358720 3:155871871-155871893 GAAGGTGCCCAATTCAAAAGCGG - Intronic
964747303 3:160024420-160024442 GAAGATGCCCACTTCATATGCGG + Intronic
969820183 4:9714040-9714062 GAAGATGCCCAGCTCAGATATGG - Intergenic
974693149 4:65327893-65327915 TAAGATGACCATTTAATATGTGG - Intronic
977994319 4:103484082-103484104 GAAGATGCCCCCTTCATGTGAGG + Intergenic
978729446 4:112008163-112008185 GAAGATGCCCAGAAAATATGAGG - Intergenic
981204037 4:142017921-142017943 ACAGATACCCACTTCATCTGGGG - Intergenic
983337810 4:166419022-166419044 GAATGTGGCCACTTCATATAGGG + Intergenic
986523628 5:8649039-8649061 GAAGAACCCCACTTTAGATGTGG + Intergenic
986558321 5:9034402-9034424 GAAAAAGCCCACTTAATATGGGG - Intergenic
991000144 5:61774564-61774586 AATAATGTCCACTTCATATGTGG + Intergenic
996069277 5:119116360-119116382 GATGATGCTCCCTTAATATGTGG - Intronic
996575455 5:124972836-124972858 GAAGATGGCCCCTTCTTCTGGGG + Intergenic
997579323 5:135007422-135007444 ACAAATGCCCACTTCATACGGGG + Intronic
998761050 5:145432914-145432936 GAAGATGCCCTGTTTAGATGGGG - Intergenic
998894614 5:146786401-146786423 GAAGGTGCCAACTTCATAATTGG - Intronic
1001092242 5:168750031-168750053 GAAGTATCCCACTTGATATGGGG - Intronic
1001757925 5:174185288-174185310 GAAGACGCCCAACTCATATTTGG - Intronic
1002522359 5:179798809-179798831 TACGAGGCCCACTTCAGATGCGG + Intronic
1007705540 6:43788531-43788553 GAGCATGCCCACTGCATCTGAGG - Intergenic
1008110245 6:47484281-47484303 GAAAATGCCTACTTCATTTGTGG - Intronic
1008167667 6:48159193-48159215 GAAGGTGCCAACCTCTTATGTGG - Intergenic
1012962287 6:105635013-105635035 GGTTATGCCCACTTCATGTGTGG + Intergenic
1013915066 6:115327079-115327101 GATGAAGCCCATTTCATATTTGG + Intergenic
1018316368 6:162560906-162560928 AAAGATGCCCACTGGGTATGAGG + Intronic
1018390522 6:163337686-163337708 GTAGATACCCACTTCAAAAGTGG - Intergenic
1023237547 7:38106341-38106363 GAAAATGCACTCTTCATATCAGG + Intergenic
1023362354 7:39429917-39429939 GAAGTTGTCCATTTCATCTGTGG - Intronic
1027784454 7:82562985-82563007 GAAGAGGTCAACTTCATATGGGG + Intergenic
1028623855 7:92855004-92855026 GAAGATGCCGAGTTTATATGTGG + Intergenic
1029893497 7:103956953-103956975 GAAGATTAACACTTCATATATGG + Intronic
1031010433 7:116521028-116521050 ACAGTTGCCCATTTCATATGTGG - Intergenic
1036573363 8:10001619-10001641 CAAGTTGCCAACTCCATATGAGG - Intergenic
1036616876 8:10394925-10394947 GAAGAGACTCAGTTCATATGTGG - Intronic
1043739311 8:83789935-83789957 AATGATGCCCACTCCATATTGGG - Intergenic
1045361028 8:101433350-101433372 GAATTTTCCCACTTCAAATGTGG + Intergenic
1050206095 9:3197834-3197856 GGAGATGCCTCCTTCAAATGTGG - Intergenic
1050462909 9:5892484-5892506 GAAGATGCTCACTTCATCTATGG + Exonic
1053546202 9:39025674-39025696 AAATATCCACACTTCATATGTGG - Intergenic
1053810518 9:41847333-41847355 AAATATCCACACTTCATATGTGG - Intergenic
1054620075 9:67340106-67340128 AAATATCCACACTTCATATGTGG + Intergenic
1054774059 9:69109760-69109782 AAAGATGCCCACCTCCTAGGTGG - Intergenic
1055938427 9:81625209-81625231 GAAGATGCCCTCTTGAGATCTGG - Intronic
1056876500 9:90338445-90338467 GAAGATACCCATTTCAGAGGAGG - Intergenic
1058067827 9:100568438-100568460 GAAGGTGCCCTCTTTAAATGAGG + Intronic
1058583983 9:106487046-106487068 GTAGATGTCCACTTCATTTGTGG + Intergenic
1058874199 9:109228734-109228756 GTAGATGCTCACTTCAGTTGGGG - Intronic
1060246392 9:121950221-121950243 GAAGATCCCAACATCATTTGAGG - Intronic
1188486776 X:30690705-30690727 TAAGATGCACACTTTATATATGG + Intronic
1191742462 X:64450363-64450385 CAAGATCCACACTTTATATGTGG + Intergenic
1196859139 X:120011290-120011312 GAAGATGGCCTTTTCAAATGGGG - Intergenic