ID: 964747303

View in Genome Browser
Species Human (GRCh38)
Location 3:160024420-160024442
Sequence GAAGATGCCCACTTCATATG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 114
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 102}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964747301_964747303 20 Left 964747301 3:160024377-160024399 CCTCAAGAACTATTAGAATACAT 0: 1
1: 0
2: 1
3: 54
4: 480
Right 964747303 3:160024420-160024442 GAAGATGCCCACTTCATATGCGG 0: 1
1: 0
2: 1
3: 10
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964747303 Original CRISPR GAAGATGCCCACTTCATATG CGG Intronic