ID: 964747629

View in Genome Browser
Species Human (GRCh38)
Location 3:160026927-160026949
Sequence TTGGTCAGTGACTGGCTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 146}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964747629_964747641 11 Left 964747629 3:160026927-160026949 CCTGTAAGCCAGTCACTGACCAA 0: 1
1: 0
2: 2
3: 13
4: 146
Right 964747641 3:160026961-160026983 GCCTGCTGGATAAGGGCAGGGGG 0: 1
1: 0
2: 2
3: 20
4: 287
964747629_964747644 20 Left 964747629 3:160026927-160026949 CCTGTAAGCCAGTCACTGACCAA 0: 1
1: 0
2: 2
3: 13
4: 146
Right 964747644 3:160026970-160026992 ATAAGGGCAGGGGGAAAGGCTGG 0: 1
1: 0
2: 0
3: 54
4: 574
964747629_964747639 9 Left 964747629 3:160026927-160026949 CCTGTAAGCCAGTCACTGACCAA 0: 1
1: 0
2: 2
3: 13
4: 146
Right 964747639 3:160026959-160026981 TGGCCTGCTGGATAAGGGCAGGG 0: 1
1: 0
2: 1
3: 23
4: 215
964747629_964747636 3 Left 964747629 3:160026927-160026949 CCTGTAAGCCAGTCACTGACCAA 0: 1
1: 0
2: 2
3: 13
4: 146
Right 964747636 3:160026953-160026975 TGGATGTGGCCTGCTGGATAAGG 0: 1
1: 0
2: 2
3: 16
4: 161
964747629_964747637 4 Left 964747629 3:160026927-160026949 CCTGTAAGCCAGTCACTGACCAA 0: 1
1: 0
2: 2
3: 13
4: 146
Right 964747637 3:160026954-160026976 GGATGTGGCCTGCTGGATAAGGG 0: 1
1: 0
2: 2
3: 7
4: 191
964747629_964747647 29 Left 964747629 3:160026927-160026949 CCTGTAAGCCAGTCACTGACCAA 0: 1
1: 0
2: 2
3: 13
4: 146
Right 964747647 3:160026979-160027001 GGGGGAAAGGCTGGAGGGAAAGG 0: 1
1: 0
2: 14
3: 161
4: 1406
964747629_964747646 24 Left 964747629 3:160026927-160026949 CCTGTAAGCCAGTCACTGACCAA 0: 1
1: 0
2: 2
3: 13
4: 146
Right 964747646 3:160026974-160026996 GGGCAGGGGGAAAGGCTGGAGGG 0: 1
1: 0
2: 9
3: 145
4: 1196
964747629_964747645 23 Left 964747629 3:160026927-160026949 CCTGTAAGCCAGTCACTGACCAA 0: 1
1: 0
2: 2
3: 13
4: 146
Right 964747645 3:160026973-160026995 AGGGCAGGGGGAAAGGCTGGAGG 0: 1
1: 2
2: 7
3: 149
4: 1170
964747629_964747635 -3 Left 964747629 3:160026927-160026949 CCTGTAAGCCAGTCACTGACCAA 0: 1
1: 0
2: 2
3: 13
4: 146
Right 964747635 3:160026947-160026969 CAAAGGTGGATGTGGCCTGCTGG 0: 1
1: 0
2: 1
3: 21
4: 183
964747629_964747638 8 Left 964747629 3:160026927-160026949 CCTGTAAGCCAGTCACTGACCAA 0: 1
1: 0
2: 2
3: 13
4: 146
Right 964747638 3:160026958-160026980 GTGGCCTGCTGGATAAGGGCAGG 0: 1
1: 0
2: 3
3: 21
4: 211
964747629_964747643 16 Left 964747629 3:160026927-160026949 CCTGTAAGCCAGTCACTGACCAA 0: 1
1: 0
2: 2
3: 13
4: 146
Right 964747643 3:160026966-160026988 CTGGATAAGGGCAGGGGGAAAGG 0: 1
1: 0
2: 2
3: 48
4: 556
964747629_964747640 10 Left 964747629 3:160026927-160026949 CCTGTAAGCCAGTCACTGACCAA 0: 1
1: 0
2: 2
3: 13
4: 146
Right 964747640 3:160026960-160026982 GGCCTGCTGGATAAGGGCAGGGG 0: 1
1: 1
2: 2
3: 22
4: 276

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964747629 Original CRISPR TTGGTCAGTGACTGGCTTAC AGG (reversed) Intronic
901120063 1:6884023-6884045 GTGCTCAGTGGCTGCCTTACTGG + Intronic
901146418 1:7067833-7067855 ATGGTCAGTGATTGGTTTAGGGG + Intronic
901177951 1:7318320-7318342 TTGGTCAGTGACTGGTTGGCTGG + Intronic
901804965 1:11732782-11732804 TTGTTCTGTGACTGCCTCACGGG - Intergenic
902862709 1:19257628-19257650 TAGCTCAGTGACAGGCTTCCAGG - Intronic
902883536 1:19388850-19388872 TTGGTTAGTACCTGGCATACTGG - Intronic
903481153 1:23654360-23654382 TTGTTCATTGAGTGACTTACTGG - Intergenic
905512186 1:38530311-38530333 TTGGTCAGTGCCTGCCTGCCTGG + Intergenic
906238423 1:44226249-44226271 GTGGTCAGTGACTGACTAAAGGG + Intronic
908781900 1:67698651-67698673 TCCGTCAGTGCCTGGCTTAGAGG + Intergenic
908900867 1:68955033-68955055 TTGGCCATTGACTGATTTACAGG - Intergenic
909467674 1:75991545-75991567 TTGGTTAGAGACTGCCTTCCTGG + Intergenic
909684728 1:78335036-78335058 GTGGACAGTGACTGTCTTAAGGG - Intronic
912363751 1:109115890-109115912 CTTATCAGTGACTGGCTCACTGG + Intronic
915562713 1:156696738-156696760 TTGGTCACTGAGTGGCTGGCGGG - Intergenic
916124011 1:161553201-161553223 TTGGTGAGTGATTGGCTGAGGGG + Intergenic
916133894 1:161634563-161634585 TTGGTGAGTGATTGGCTGAGGGG + Intronic
919296184 1:195703277-195703299 TTTGCCAGTGATTGGCTTAGGGG - Intergenic
921184472 1:212657728-212657750 GAGGTGAGTGACTTGCTTACAGG - Intergenic
921814364 1:219547140-219547162 TTGTTAATTGACTGGCTTACTGG + Intergenic
1063980031 10:11445381-11445403 TTGCACAGTGCCTGGCATACAGG + Intergenic
1066956694 10:42179540-42179562 TTGCTCAGAAACTGGCTTGCAGG - Intergenic
1069824456 10:71246552-71246574 TTGGTGAGTGACTGGGTTGAGGG + Intronic
1071223469 10:83497475-83497497 CGGGGCAGTGGCTGGCTTACAGG - Intergenic
1071293330 10:84202476-84202498 CTGGTCACAGCCTGGCTTACAGG + Intronic
1071347506 10:84706737-84706759 ATGGCCAGTGACAGGCTTTCAGG + Intergenic
1077315999 11:1919625-1919647 TTGGCCAGTGACTGGGTGGCCGG - Exonic
1086432023 11:86745289-86745311 TTGGGAAGTGACTAGGTTACAGG - Intergenic
1088526723 11:110763743-110763765 TTGGCCAGTGACTGGCTGCCAGG - Intergenic
1088858648 11:113779732-113779754 TGGGTCAGTGACTGGTTAGCAGG - Exonic
1088888297 11:114024847-114024869 TTGGCCATGGACTGTCTTACAGG + Intergenic
1089894410 11:121914724-121914746 TTGGCCAGTCACTGGCTCCCAGG - Intergenic
1095886169 12:47190729-47190751 TGTGTCAGTGTTTGGCTTACTGG - Intronic
1099150075 12:79099777-79099799 TATGACAGTGACTGGCTTACTGG + Intronic
1099709887 12:86210281-86210303 TGGGGCAGTCACTGGCTTGCAGG + Intronic
1101612575 12:106304346-106304368 GTGGACAGTGACTGGCTTGTTGG + Intronic
1102545493 12:113651936-113651958 TGGGGCAGTGCCTGGCATACAGG + Intergenic
1104402397 12:128487081-128487103 TTGGTCGGTGGCTGGGTTTCCGG - Intronic
1105967845 13:25400779-25400801 TGTGGCAGTTACTGGCTTACGGG + Intronic
1106561920 13:30854200-30854222 ATGGTCAGGGGCTGGCTTAGAGG + Intergenic
1107089179 13:36457994-36458016 TTGGTCATTGACTGGAATGCTGG + Intergenic
1107567709 13:41623021-41623043 TTTGTCAGTGACTGGTCTAGGGG + Intronic
1107695863 13:42999302-42999324 TTGGTCAAGGACTGTCTTACTGG - Intergenic
1108023422 13:46153119-46153141 GTGGTCGGTGTCTGGGTTACTGG - Intronic
1113227555 13:108176005-108176027 TTGGTCATTCACTGACTGACAGG - Intergenic
1115640338 14:35331755-35331777 TTGGTCAGTGGGCAGCTTACTGG + Intergenic
1117357518 14:54939209-54939231 TTAATCAGTGACTGTCTTATGGG - Exonic
1125372674 15:38995303-38995325 TTGGCCCGTGACTGGCTTTGGGG + Intergenic
1126593211 15:50360166-50360188 TTGCACAGTGGCTGGCATACAGG - Intergenic
1130575075 15:85084876-85084898 TTGGTCAGTGACTGGATTTAGGG - Intronic
1132114529 15:99125844-99125866 TTCGCGAGTGACTGGCTGACAGG + Intronic
1133634830 16:7654990-7655012 CTGGCCAGTGACTGGCTTTCTGG + Intronic
1135220778 16:20612522-20612544 TTGCTGAGAGACTGGCTTAGTGG + Intronic
1139462601 16:67134465-67134487 CAGGTCAGTGACTGGCTTTGAGG + Exonic
1140036736 16:71376981-71377003 CTTGCCAGTGATTGGCTTACAGG - Intronic
1144720513 17:17466395-17466417 TTGGCCAGTGACTGGTCTACAGG - Intergenic
1145887492 17:28392720-28392742 TTCGTCCTTGACTGGCTTCCTGG - Intronic
1146031330 17:29368475-29368497 TGTGTCAGTGACTGCCTTCCAGG - Intergenic
1146593200 17:34146609-34146631 GTGGCCAGTGACTGACTGACAGG - Intronic
1146695102 17:34902917-34902939 GTAGTCAGTGCCTGGCTTCCTGG + Intergenic
1148504030 17:48113426-48113448 TGGGTCTGTGACTGGCTTTTTGG + Intronic
1149589651 17:57818982-57819004 TTAGTCAATGACTGGCTGATGGG + Intergenic
1151150873 17:72085347-72085369 TTGGTCAGCAATTGGCTTAGAGG - Intergenic
1153153093 18:2117041-2117063 TTGGTCAGTGATTTTCTTGCAGG - Intergenic
1163979112 19:20881975-20881997 GTGGTGAATGAGTGGCTTACAGG - Intergenic
1165946792 19:39448303-39448325 TTGGAGAGTGCCTGGCTTCCAGG + Intronic
1166042007 19:40209243-40209265 TTGTTCACTGACTGACTGACTGG - Intronic
1202639537 1_KI270706v1_random:69665-69687 TTGGTCAGTAACTGGCCTGCTGG - Intergenic
1202709982 1_KI270714v1_random:13498-13520 TTTGGCAGTGACTTGCTTTCCGG + Intergenic
925522473 2:4762133-4762155 GTGGTCAGTGAGTAGCTGACAGG + Intergenic
925843670 2:8016741-8016763 TTGCTCAGCAACTGGCTTGCTGG - Intergenic
929755003 2:44757090-44757112 TTGATCTGTGCCTGGCTTACAGG + Intronic
931070070 2:58636907-58636929 TAGGTCAGGGACTGGGTTGCAGG + Intergenic
932106332 2:68946274-68946296 TTGGTGAGTGAATGACTTATTGG + Intronic
935189852 2:100768407-100768429 TTTGCCTGTGGCTGGCTTACTGG - Intergenic
938312182 2:130300648-130300670 TTGCTCAGTCTCTGGCTTAGAGG - Intergenic
938469032 2:131543194-131543216 CTGCTCAGTGACCGGCTTAGAGG - Intergenic
940693553 2:156950637-156950659 ATGGTCAGTGACTGGGTGATGGG - Intergenic
948509113 2:238451284-238451306 TTGCTCAGTGCCTGGATTGCAGG + Exonic
1174118212 20:48242535-48242557 TAGGCCAGTGGCTGGTTTACTGG - Intergenic
1174168861 20:48604076-48604098 TAGGGCTGTGACTGGCTTCCTGG - Intergenic
1175438516 20:58973103-58973125 TTGGTCAAGGACTGCCCTACGGG - Intergenic
1176031026 20:63011765-63011787 GAGGTCACTGACTGGCTCACGGG - Intergenic
1179388995 21:40970227-40970249 TTGGTCAGCAACTGGCATCCAGG + Intergenic
1180098595 21:45573816-45573838 CTGGTCTGTGACTGGCTCCCAGG + Intergenic
1180362404 22:11912205-11912227 TTGGTCAGTACCTGGCCTGCTGG + Intergenic
1183388441 22:37528747-37528769 CTCATCAGTGACTGGCATACAGG + Intergenic
1183551407 22:38488577-38488599 TTGCTCTGTGACTGGTTTAAAGG - Intronic
950374376 3:12557971-12557993 TTGGTCAGCTTGTGGCTTACTGG + Intronic
950591800 3:13941339-13941361 GAGGTCACTGATTGGCTTACAGG + Intronic
950615750 3:14156653-14156675 TTGATCTGTAACTGACTTACTGG - Intronic
952128000 3:30324706-30324728 TTGCTAAGTGCCTGGCTTTCAGG + Intergenic
953055285 3:39383158-39383180 TTGGCTAGTGGCTGCCTTACTGG + Intergenic
955240435 3:57173462-57173484 TTGCACAGTGCCTGGCATACAGG - Intergenic
960437600 3:117646178-117646200 TTAGACAGAGCCTGGCTTACAGG - Intergenic
961392964 3:126567408-126567430 TTGATCACTGACTTGCTTTCTGG - Intergenic
964747629 3:160026927-160026949 TTGGTCAGTGACTGGCTTACAGG - Intronic
966068790 3:175849064-175849086 TGGGTCAGTGAATGGCTTTTGGG + Intergenic
967889441 3:194354615-194354637 TGGCTCAGCCACTGGCTTACTGG + Intergenic
968898695 4:3420439-3420461 TTGGTCCCTGACTGGCTTCCAGG + Intronic
969307496 4:6334315-6334337 ATGGTCAGTGGATGGCATACAGG - Intronic
969630699 4:8334246-8334268 TTGGGCAGTGACTGGCTAGAAGG + Intergenic
974209953 4:58758971-58758993 TTGGTGAGTGACTGCTTTCCAGG - Intergenic
974922581 4:68260506-68260528 TTTGTAACTGACTGGTTTACTGG - Intergenic
975378561 4:73672245-73672267 TTTGTCAGTGATTGGTTTAGGGG - Intergenic
975799474 4:78044844-78044866 TTGGACAGTAACTGCCTTAATGG + Intergenic
981312533 4:143311256-143311278 TTTGACAGTAACTGCCTTACAGG - Intergenic
982016829 4:151162881-151162903 TTGGTCTTTGACTGGCATATAGG + Intronic
982172599 4:152676215-152676237 TGGGTCAGAGACTGGCTGAGAGG - Intronic
983618124 4:169730416-169730438 TTGGTCAATGACTGTCATTCTGG + Intronic
987198614 5:15552323-15552345 GTGGTCAGTGACTGGCACAGAGG - Intronic
988018293 5:25589910-25589932 TTGGGCAATGACTGGCTTTAGGG + Intergenic
990490849 5:56301351-56301373 TTTGCCAGTGACTGGTTTAAGGG + Intergenic
991949790 5:71936289-71936311 TGGGGCAGGGACTGGCTTCCAGG + Intergenic
995694018 5:114859466-114859488 TTGCTCAAGGACTGGCTGACTGG - Intergenic
995918534 5:117280731-117280753 TTGGAAAGTGACTGGATTATTGG - Intergenic
996277025 5:121679430-121679452 TTTGTCTATGATTGGCTTACAGG - Intergenic
996370131 5:122744303-122744325 TTGGTCAGTGATAGGTTTAAAGG + Intergenic
1002181384 5:177432804-177432826 GTGGGCAGGGACAGGCTTACCGG - Exonic
1004745889 6:18508777-18508799 TTGGTCTGTGAGTAGATTACTGG - Intergenic
1007353206 6:41290662-41290684 TTTGTAACTGACTGGTTTACTGG + Intergenic
1008615194 6:53219557-53219579 TTGGACAGTGACAGGCATGCTGG + Intergenic
1009650537 6:66471740-66471762 CTGATCAATGACTGGCTTTCAGG + Intergenic
1012030838 6:94060444-94060466 TTGGTGAGAGGCTGGCTTAGAGG + Intergenic
1014617659 6:123623768-123623790 TTGGTCAGGGACTGACATAAAGG - Intronic
1015034098 6:128631431-128631453 TTGGTCAGTGAATGTATTAAAGG - Intergenic
1017756832 6:157536678-157536700 ATGTTTAGAGACTGGCTTACAGG - Intronic
1020286201 7:6682996-6683018 TTGTTCAGAGAGTGGCTTCCAGG + Intergenic
1022336909 7:29430906-29430928 TTTGTCAATGACTGGCTTACAGG - Intronic
1026054032 7:66969575-66969597 ATGGACAGGGAGTGGCTTACTGG + Intergenic
1027660228 7:80979985-80980007 ATGTTCAGCGACTGGCTTAAAGG - Intergenic
1028061111 7:86317380-86317402 TTGTTCAGTGACTGGCACAGAGG + Intergenic
1029623172 7:101702650-101702672 AGGGTTAGTGACTGGCTTGCTGG + Intergenic
1031658322 7:124387150-124387172 ATGGTCAATGACAGGGTTACGGG - Intergenic
1033067613 7:138171374-138171396 TTTGTAAGTGACTAGCTTAAAGG + Intergenic
1034792910 7:153988017-153988039 TTGTTTAGGGACTGGCTTCCAGG - Intronic
1035433233 7:158838179-158838201 GTGGGCGGTGACTGGCTCACAGG - Intergenic
1036474398 8:9080045-9080067 TTTGTCAGGAGCTGGCTTACAGG + Intronic
1037079688 8:14768835-14768857 TTTGTCAGTGACTGACTTACTGG - Intronic
1039250727 8:35661247-35661269 TTGGAAAGGGACTGGCATACTGG + Intronic
1045791786 8:105992057-105992079 TTGGCTAGTTACTGGCTCACAGG - Intergenic
1047631955 8:126717434-126717456 TTGCTCAGAGACTAGCTTTCTGG + Intergenic
1051243989 9:15090762-15090784 TTGGGCAGTGACTTGGTTGCTGG - Intergenic
1055145650 9:72931516-72931538 TTTCTTAGTGACTGGGTTACAGG + Intronic
1055293637 9:74811794-74811816 ATGGAAAGTGACTGGCTTGCAGG + Intronic
1056471687 9:86910595-86910617 TTGGTCAGAGATTTGCTTACAGG - Intergenic
1057434823 9:95030190-95030212 TGGTTGAGTGACTGGATTACTGG - Intronic
1057561859 9:96134181-96134203 TTGGTCAGTGTCTGACTTTCTGG + Intergenic
1058023549 9:100116821-100116843 TTGGTCAGTGAATTCCTGACAGG + Intronic
1062649741 9:137569438-137569460 TGGGTGAGTGACTGGCTGGCTGG - Intronic
1203547646 Un_KI270743v1:140397-140419 TTGGTCAGTACCTGGCCTGCTGG - Intergenic
1186151851 X:6683115-6683137 GTGGGAAGTGACTGGATTACGGG - Intergenic
1186442928 X:9601458-9601480 TGCCTCAGTGACTGGCTTCCAGG - Intronic
1187401762 X:18966735-18966757 TTAGACAGGGACTGGCTGACAGG - Intronic
1194187734 X:90793979-90794001 TTTGTCACTGACTAGCTTGCTGG - Intergenic
1194700802 X:97111371-97111393 TTAGTCCCTGATTGGCTTACTGG + Intronic
1196903986 X:120413819-120413841 TTTGTCAGTGACTGCTTTAGGGG - Intergenic
1196975531 X:121154044-121154066 GAGGTCACTGACTGGCTCACAGG - Intergenic
1197284523 X:124580817-124580839 ATGCTCAGTGCCTGGATTACAGG - Intronic
1198678512 X:139156474-139156496 TTGCTAAGTGACTCCCTTACTGG + Intronic
1199453742 X:148003643-148003665 TGGGTCAGTGACTGAATTTCAGG - Intronic
1200534321 Y:4375931-4375953 TTTGTCACTGACTAGCTTGCTGG - Intergenic