ID: 964748195

View in Genome Browser
Species Human (GRCh38)
Location 3:160031223-160031245
Sequence ATCTTCAGCAAAAGGAACTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 469
Summary {0: 1, 1: 0, 2: 1, 3: 50, 4: 417}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964748193_964748195 -3 Left 964748193 3:160031203-160031225 CCATGCATCACTATTAAGGCATC 0: 1
1: 0
2: 0
3: 6
4: 74
Right 964748195 3:160031223-160031245 ATCTTCAGCAAAAGGAACTATGG 0: 1
1: 0
2: 1
3: 50
4: 417
964748190_964748195 20 Left 964748190 3:160031180-160031202 CCTACACCAATGGCTAATTGAGA 0: 1
1: 0
2: 0
3: 3
4: 113
Right 964748195 3:160031223-160031245 ATCTTCAGCAAAAGGAACTATGG 0: 1
1: 0
2: 1
3: 50
4: 417
964748191_964748195 14 Left 964748191 3:160031186-160031208 CCAATGGCTAATTGAGACCATGC 0: 1
1: 0
2: 0
3: 5
4: 115
Right 964748195 3:160031223-160031245 ATCTTCAGCAAAAGGAACTATGG 0: 1
1: 0
2: 1
3: 50
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964748195 Original CRISPR ATCTTCAGCAAAAGGAACTA TGG Intronic
900249089 1:1657417-1657439 TTCTTCAGGAAAAGAAACGAAGG - Exonic
900260035 1:1722750-1722772 TTCTTCAGGAAAAGAAACGAAGG - Exonic
901191464 1:7413200-7413222 ATCTTAAGCCAAAAGAACAAAGG - Intronic
902931205 1:19732760-19732782 ACCTTCAGAAAAAAGAACTTGGG - Intronic
904759489 1:32791863-32791885 ATCTTGAGCGAAGGGAAGTAAGG + Intronic
905230635 1:36512987-36513009 ATATTCAACAAAAAGAACAATGG + Intergenic
906274475 1:44505989-44506011 ATTTTCAACAAAAGGAAATAAGG - Intronic
906425109 1:45705267-45705289 TCCTTCACCAAAAGGAAATAAGG + Intronic
907754377 1:57296432-57296454 TTTTTCAGCAAAAGAAACCAAGG + Intronic
908519163 1:64924694-64924716 ATCTTCAGCAAATTGAAAGATGG + Intronic
908587313 1:65584254-65584276 TTCTTCAACAAAAGGAACGATGG - Intronic
910150563 1:84138088-84138110 TTCTCCAGTAAAAGGAACTAAGG + Intronic
910290109 1:85591815-85591837 ATCTTCACTAAAAGGAAAGAAGG + Intergenic
910345523 1:86231956-86231978 ATTTTAAGGAAAAGAAACTATGG - Intergenic
910618469 1:89226644-89226666 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
910701983 1:90085293-90085315 CTCCTCACCAAAAGGAATTAGGG - Intergenic
911492130 1:98583188-98583210 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
912531473 1:110326903-110326925 TTCTTCAGAAAAAGAAACTGAGG - Intergenic
912675228 1:111674050-111674072 TTCTACAGCAACAGAAACTAGGG - Intronic
912704087 1:111899090-111899112 ATCTTCAGCAAGAAGCACTGTGG - Intronic
913362552 1:117998498-117998520 ATCCTAAGCAAAAAGAACAAAGG - Intronic
915276000 1:154788574-154788596 ATCTTCATGAAAATGAACCATGG - Intronic
917003974 1:170391189-170391211 ATCTTTAGCTAGATGAACTAAGG - Intergenic
917159677 1:172043494-172043516 AACTTCAGCAAAGGGTACTATGG + Intronic
917349060 1:174057914-174057936 ATCCTGAGCAAAAAGAACAAAGG - Intergenic
917356001 1:174126908-174126930 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
917363028 1:174197923-174197945 ATCTTCTGTAACAGGAACTATGG - Intronic
917807155 1:178624282-178624304 ATCTACATCAAAAGAAACAAGGG - Intergenic
918434638 1:184498943-184498965 ATCATAAAGAAAAGGAACTAAGG - Intronic
918436765 1:184522414-184522436 TTCTCCAATAAAAGGAACTAGGG + Intronic
918997275 1:191778615-191778637 ATCTTGAGCAAAAAGAGCAAAGG + Intergenic
919184447 1:194126832-194126854 ATTTTCATCAAAAGCAACTGAGG + Intergenic
921495898 1:215841241-215841263 ATCATAAGCAAAAAGAACAAAGG + Intronic
922716435 1:227876511-227876533 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
924271757 1:242341014-242341036 GTCTTCATGAAAAGGAACCAGGG + Intronic
924543421 1:245002732-245002754 ATCTTCCAGAAAAGAAACTAAGG - Intronic
1066013247 10:31213564-31213586 TTCCCCAGTAAAAGGAACTAGGG - Intergenic
1066087711 10:31987209-31987231 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
1066712917 10:38255114-38255136 GTCTTCATGAAAAGGAACCAGGG - Intergenic
1067483916 10:46627295-46627317 ATCTTTAGTGAAAGAAACTAAGG - Intergenic
1067487698 10:46666962-46666984 TTCTCCAGTAAAAGGAACCAAGG + Intergenic
1067493785 10:46742445-46742467 ATCTTAAGCTAAAAGAACAAAGG - Intergenic
1067600874 10:47597960-47597982 ATCTTAAGCTAAAAGAACAAAGG + Intergenic
1067607108 10:47675040-47675062 TTCTCCAGTAAAAGGAACCAAGG - Intergenic
1067610843 10:47714348-47714370 ATCTTTAGTGAAAGAAACTAAGG + Intergenic
1068257202 10:54527822-54527844 TTCTTCATCAATAGCAACTATGG + Exonic
1068952045 10:62787334-62787356 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
1071622667 10:87136411-87136433 TTCTCCAGTAAAAGGAACCAAGG - Intronic
1071652416 10:87405827-87405849 ATCTTAAGCTAAAAGAACAAAGG + Intergenic
1071877383 10:89855812-89855834 AGCTTCAGAAAACAGAACTATGG - Intergenic
1072749510 10:97967427-97967449 TTCTCCAGCAAAAGGAAACAAGG - Intronic
1072965088 10:99964946-99964968 AGCTTCAGGAAAAGGAAGAAGGG + Intronic
1073177532 10:101565552-101565574 ATCTGCAGCAAGAGGGACTTAGG - Intergenic
1074261579 10:111858982-111859004 ATCTCCAAAAAAAGGAACTAGGG - Intergenic
1074804257 10:117031802-117031824 ATCTTCACTAAAAGGAAGAAAGG + Intronic
1074984733 10:118647759-118647781 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1075010378 10:118863804-118863826 ATCCTAAGCAAAAAGAACAAGGG - Intergenic
1075102018 10:119513105-119513127 ATGCTCAGCAAAAGAAACTTGGG - Intronic
1075513953 10:123094670-123094692 AGCCTCAGCAGAAGGAACCATGG - Intergenic
1075966760 10:126618626-126618648 TACTTCAGTAAAAGGAACTGAGG - Intronic
1077968575 11:7163040-7163062 TTCTCCAACAAGAGGAACTATGG + Intergenic
1078875929 11:15397155-15397177 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1079764288 11:24371307-24371329 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1080162047 11:29188593-29188615 ATTTTCAAAAAAACGAACTATGG + Intergenic
1080841665 11:35989316-35989338 ATCCTAAGCAAAAAGAACAAAGG - Intronic
1083097725 11:60268674-60268696 ATTTTCAGCAAAAGGAACACAGG - Intergenic
1084583798 11:70041969-70041991 TTCTCCATAAAAAGGAACTAGGG + Intergenic
1086542812 11:87932865-87932887 ATCAGCAGCAAAGGGACCTAGGG + Intergenic
1087236327 11:95722937-95722959 TTCTCCAGTAAAAGGAACTAGGG + Intergenic
1087680220 11:101211685-101211707 ATCTTAAACAATAGGAAATAGGG + Intergenic
1088205152 11:107383787-107383809 ATCAACAGCAAAAGGCAATAGGG + Intronic
1088959150 11:114643702-114643724 ATCTTAAGCAAAAAGAACAAAGG - Intergenic
1089331440 11:117691727-117691749 ATGTTCAGAAAAAGGAACAGGGG + Intronic
1090147981 11:124347719-124347741 ATCAGTAGCAAAAGGAACTCTGG + Intergenic
1090488192 11:127133833-127133855 TTCTCCAATAAAAGGAACTACGG + Intergenic
1090579018 11:128139770-128139792 TTATTAAGTAAAAGGAACTAAGG - Intergenic
1090648571 11:128786786-128786808 AGATTCAGCATGAGGAACTAAGG - Intronic
1092600804 12:10061952-10061974 ATTTTAATCAGAAGGAACTATGG - Intronic
1093160007 12:15735296-15735318 TTCTTAAGCAAAAGCAACTATGG - Intronic
1093339811 12:17959913-17959935 ATCTTTAGCAAATAGAATTAAGG + Intergenic
1094578986 12:31716113-31716135 ATGTTGAGCAAAAGAAACCATGG - Intronic
1094634673 12:32214255-32214277 GTCTACAGTAAAAAGAACTAGGG - Intronic
1094787155 12:33861611-33861633 ATCTTCACTAAAAGGAAGAAAGG - Intergenic
1095224361 12:39662090-39662112 ATCCTGAGCAAAAAGAACAAAGG - Intronic
1097295314 12:57957027-57957049 ATTATCAGAAAAAGTAACTATGG + Exonic
1098026422 12:66207830-66207852 ATCAGCAGCAAAAGGAAATTTGG - Intronic
1098745084 12:74226335-74226357 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1098845681 12:75532831-75532853 GTCTTCAGTGAAAGGTACTAGGG + Intergenic
1098868694 12:75791088-75791110 AAATTCAGCAACAGGAACTTTGG - Intergenic
1100351409 12:93787107-93787129 ATCTTCAGCAGAATGTGCTAAGG - Intronic
1101226877 12:102696809-102696831 ATCTTCAGTAAAAGGAAGACAGG + Intergenic
1101677236 12:106928300-106928322 TTCTTCAAGAAAAGGATCTAGGG - Intergenic
1102384454 12:112496367-112496389 ATCTAAAGTAAAAGGAACCAGGG - Intronic
1102678224 12:114672877-114672899 ATCTTAAGCAAAAGGAAACTGGG + Intronic
1102771832 12:115484204-115484226 ATCTTCAGCAAAAAGATCCAAGG - Intergenic
1102944589 12:116974815-116974837 TTCTTCAATAAAAGGAACAAGGG + Intronic
1103168444 12:118791356-118791378 ATCTGCACCAAAAGGCACCATGG - Intergenic
1105843593 13:24275971-24275993 TTTTTCAACAAAAGAAACTACGG + Intronic
1107084980 13:36417182-36417204 TTCTTCAGGAAAAGGATCAAAGG + Intergenic
1107743266 13:43477518-43477540 ATCTTCAGAAAGAGAAACAATGG + Intronic
1108510859 13:51154496-51154518 TGCTTCAGCCAATGGAACTAAGG + Intergenic
1108958882 13:56197142-56197164 ATCTTCAGAGAAAGGGGCTAGGG - Intergenic
1109271717 13:60263081-60263103 ATCTTGAGAAAGAGGAACCAAGG + Intergenic
1109875147 13:68392721-68392743 ATCTTCATGAAAAGGAATGAAGG + Intergenic
1109943171 13:69397633-69397655 ATCTTAAGCAAAAAGAACAAAGG - Intergenic
1110034077 13:70656574-70656596 ATTTTCAACAAAAGAAAGTAAGG + Intergenic
1110230373 13:73161626-73161648 ATCTTCATAAAAAGGAAACAAGG - Intergenic
1110795649 13:79634439-79634461 TTCTCCAGTAAGAGGAACTAGGG + Intergenic
1111769409 13:92578107-92578129 CTCTACTGCAAAAGGAGCTAGGG - Intronic
1112742423 13:102490118-102490140 ACATTCAGCAAAGGGAACCAAGG + Intergenic
1113363382 13:109652612-109652634 AGATTCAGCAAAAGCAACTATGG + Intergenic
1113870688 13:113558119-113558141 ATCTTCCGCTAGAAGAACTAGGG + Intergenic
1114136145 14:19853686-19853708 ATCCTAAGCAAAAGTAACAAAGG - Intergenic
1114976840 14:28112356-28112378 TTCTACAACAAAAGAAACTAGGG + Intergenic
1115135429 14:30102165-30102187 ATCCTAAGCAAAAAGAACAAAGG + Intronic
1115668630 14:35583013-35583035 ATGCTCAGTAAAAGGAACTCTGG - Intronic
1115698595 14:35925962-35925984 ATCTTCTGCTAAAGGAACGCTGG + Intronic
1115919119 14:38353229-38353251 ATGTTCAACAGAAGAAACTAAGG - Intergenic
1115933229 14:38521726-38521748 CTTTCCACCAAAAGGAACTATGG + Intergenic
1116487849 14:45472738-45472760 AAATTCAGCAATAGGAACAACGG + Intergenic
1116493079 14:45528427-45528449 CTTTTCACCTAAAGGAACTATGG + Intergenic
1116639993 14:47448702-47448724 ATTTGCAGCATAAGGAACTCAGG - Intronic
1117007294 14:51434312-51434334 TTCTTCAATAAAAGGAACCAGGG + Intergenic
1117611648 14:57489250-57489272 ATCCTCAGCAAAACTAACTCAGG + Intronic
1117984265 14:61372194-61372216 TTCTCCAACAAAAGGAACCAGGG - Intronic
1118575736 14:67240218-67240240 ATCTTCACCACCAGGAACAACGG + Intergenic
1118959619 14:70516973-70516995 CCCTTCACCAAAGGGAACTATGG + Intergenic
1119121324 14:72080962-72080984 ATCTTGAGCAAAAAGAACAAAGG - Intronic
1119214093 14:72855408-72855430 ATTTACAGAAAAAGTAACTAAGG + Intronic
1119268551 14:73280529-73280551 ATCTGGAGTAAAAGGAACAAGGG - Intronic
1119735947 14:76982154-76982176 TTCTCCACTAAAAGGAACTAGGG + Intergenic
1121055108 14:90845744-90845766 AGCCTCAGCAACAGGAACTGGGG + Intergenic
1123806853 15:23882551-23882573 CTCTCCAGTAAAAGGAACTGAGG - Intergenic
1124199891 15:27670164-27670186 TTCTCCAGTAAAAGGAACCAGGG + Intergenic
1125292551 15:38165950-38165972 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1126613316 15:50551450-50551472 TTCTTCACTAAAAGGAACCAGGG - Intergenic
1126763882 15:51994282-51994304 TTCTCCACCAAAAGGAACCAGGG + Intronic
1127040577 15:54971460-54971482 ATCTTGAGCAAAAAGAACAAAGG + Intergenic
1127252559 15:57256182-57256204 AGCTTCAGCAAAAAGACCAAAGG + Intronic
1127589305 15:60407666-60407688 TTCATCAGCTAAAGCAACTAGGG + Intergenic
1128394164 15:67206855-67206877 TTCTCCAATAAAAGGAACTAGGG - Intronic
1128483158 15:68057022-68057044 ATCCACAGCAAAATGAAGTATGG - Intronic
1128851509 15:70962488-70962510 GTCTCCAATAAAAGGAACTATGG + Intronic
1128948907 15:71853956-71853978 ATTTACAGAAAAAGGAACTGAGG - Intronic
1129821556 15:78605534-78605556 ATCCTCAGCAAGGGGAACAATGG + Intronic
1129835189 15:78700029-78700051 ACCTTCACCAAAAGGAAGAAAGG - Intronic
1130676119 15:85953492-85953514 ATGTACAGAAAAAGAAACTAAGG - Intergenic
1130767873 15:86890833-86890855 ATCCTAAGCAAAAAGAACAAAGG - Intronic
1131658677 15:94489966-94489988 ATCCTGAGCAAAAAGAACAAAGG + Intergenic
1131973349 15:97915057-97915079 ATCTTCACAACAAGAAACTAGGG + Intergenic
1132366964 15:101264798-101264820 AACTTCAGGAAAAGGAATTCAGG + Intergenic
1134372872 16:13641738-13641760 ACTTACAGCAAAAGGAACGATGG + Intergenic
1136994464 16:35179979-35180001 TTCTTCAGTAAAAAGAACCAGGG - Intergenic
1137308937 16:47234048-47234070 GTATTAAGCAAAGGGAACTAAGG - Intronic
1137830217 16:51537058-51537080 CTCTTCGTCAAAAGGAGCTAGGG + Intergenic
1138997013 16:62467802-62467824 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1139515398 16:67449703-67449725 AGCTTTAGCAAATGGAACTGGGG - Intronic
1140038822 16:71391823-71391845 ATTTTCAGATAAAGCAACTAAGG + Intergenic
1140716832 16:77734289-77734311 ATTTTCAGACAAAGGAACTTAGG - Intronic
1141447903 16:84074508-84074530 AACTTCAGCAGAAGTAACTATGG + Intronic
1146615294 17:34351758-34351780 ATCTTCACCAAAAGGAAGATAGG + Intergenic
1148532731 17:48410469-48410491 ATCTTCAATAAAAGGAACCTAGG + Intronic
1149492311 17:57094068-57094090 AAATTAAGCAAAAGAAACTAAGG - Intronic
1150476286 17:65478357-65478379 GCCTTCAGCCAAAGGGACTAAGG + Intergenic
1150540545 17:66093871-66093893 ATTTTGAGCAAAATGAACAAAGG + Intronic
1151992582 17:77586429-77586451 ATCCTAAGCAAAAGGAACAAGGG - Intergenic
1152939349 17:83159666-83159688 ATGTTCAGCCAAAGGCACAAGGG + Intergenic
1153094739 18:1387980-1388002 ATCCTAAGCAAAATGAACAAAGG + Intergenic
1154081678 18:11263448-11263470 ATAATCAGCAAATAGAACTAAGG - Intergenic
1155255469 18:23994165-23994187 ATCTTCAGCCAAAACATCTAAGG - Intronic
1155630235 18:27884701-27884723 ATTTTTGGCAAAGGGAACTATGG - Intergenic
1156212004 18:34954513-34954535 ATCTTAAGTAAAAAGAACAATGG - Intergenic
1156967935 18:43118599-43118621 TACTTCAGCAGAAGGATCTAGGG - Intergenic
1157453593 18:47806518-47806540 ATCTTGAGAAAAAGGAACCACGG - Intergenic
1158844839 18:61430893-61430915 TTCTCCAGGAAAAGGAACCAGGG - Intronic
1159701718 18:71637382-71637404 ATCTTCAATAAAAGGAACTAGGG + Intergenic
1161773932 19:6247296-6247318 TTTTCCAGCAACAGGAACTAAGG + Intronic
1164224482 19:23230425-23230447 ATCTTGAGGAAAAAGAACAAAGG + Intronic
1165910580 19:39223967-39223989 ATCTTCAGAACAATGATCTAAGG - Intergenic
1168182246 19:54669878-54669900 ATCTTGAGCAAAGGGAAGAAGGG - Exonic
1168507582 19:56949564-56949586 TTCTTCAGCACAAGGCAGTATGG - Intergenic
925037271 2:697899-697921 ATCTCCAGTAAAAGGAACCAGGG - Intergenic
925060629 2:887213-887235 ATTTTCAGGAAAAGGCAATATGG - Intergenic
925517529 2:4700073-4700095 CTCTACAGTAAAAGGTACTATGG + Intergenic
925627300 2:5853960-5853982 AGCTTCAGCAAGAAGAGCTAGGG + Intergenic
926264775 2:11305592-11305614 CTCTTCACTAAAAGGAACTAGGG + Intronic
926533905 2:14086290-14086312 ATCCTAAGCAAAAGGAACAAAGG + Intergenic
926765903 2:16322557-16322579 ATCTTCATAAAAAGGAAATGAGG - Intergenic
927095038 2:19741768-19741790 ATGCTCAGCAAAAGGAACCAAGG + Intergenic
927289333 2:21389479-21389501 TTCTTCACCAAAAGGAACCATGG + Intergenic
928490656 2:31779205-31779227 ATCCTAAGCAAAAGGAACAAAGG + Intergenic
928883107 2:36119677-36119699 ATCTTCAATAAAAGAAACAATGG - Intergenic
928940255 2:36720188-36720210 ATCCTGAGCAAAAAGAACAAAGG + Intronic
929200964 2:39235278-39235300 AATTTCAGCAAAAGGATTTATGG + Intergenic
929371922 2:41235907-41235929 GTCTTTTGCAAAAGTAACTAGGG + Intergenic
929504558 2:42518254-42518276 TTCTCCAATAAAAGGAACTAGGG + Intronic
930908258 2:56599822-56599844 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
932045825 2:68348671-68348693 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
932366300 2:71155575-71155597 TTCTACAGCAAAATGGACTAAGG + Intergenic
932703846 2:74008643-74008665 ATCCTCAGCAACAGAAAGTAGGG - Intronic
933170362 2:79118246-79118268 AGGGTCAGCAAAAGTAACTAAGG + Intergenic
934095420 2:88597947-88597969 TTCTCCACCAAAAGGAACCAGGG + Intronic
934888431 2:98045291-98045313 AGAGTCAGCAAAGGGAACTAGGG + Intergenic
937379303 2:121362240-121362262 CCCTTCAGTAAAAGGAACTGTGG - Intronic
937762780 2:125626065-125626087 ATCTGAAGCAAAAAGAACAAAGG + Intergenic
938403023 2:131009182-131009204 ATCTTCAGAAAAATGAAAGAAGG - Intronic
938891889 2:135713689-135713711 GTCTCCATTAAAAGGAACTAGGG + Intronic
939129436 2:138216780-138216802 ATCTAAAGCAAAAGGAAGCAAGG + Intergenic
939314556 2:140531153-140531175 AGATTCATCAAAAGAAACTATGG - Intronic
939351496 2:141043966-141043988 ATCCTAAGCCAAAGGAACAAAGG + Intronic
939421821 2:141981349-141981371 ATCTTCAGGAAGATCAACTAAGG + Intronic
939548257 2:143581042-143581064 ATTTTAAGCTAAAGGAACTGAGG + Intronic
939610026 2:144298753-144298775 ATCTGTAGCAAAATGATCTAGGG + Intronic
939946057 2:148412402-148412424 ATCCTAAGTAAAAGGAACAAAGG - Intronic
940380206 2:153007318-153007340 ATATTCAGCAAATGGTACTGGGG - Intergenic
940498288 2:154461774-154461796 ATCTTAGGCAAAAGGAATTAGGG + Intergenic
940674511 2:156712355-156712377 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
940860603 2:158766788-158766810 TTCTTCAGGAAGAGGAACTGTGG - Intergenic
940975239 2:159935716-159935738 ATCTCCAGTCAAAGGAACTTAGG - Intronic
941007824 2:160265529-160265551 TTCTCCATCAAAAGAAACTAGGG + Intronic
942882279 2:180875453-180875475 ATCATCACCAAGAGGAACTCTGG + Intergenic
943038039 2:182770259-182770281 ATCCTAAGCAAAAAGAACAAAGG - Intronic
943523230 2:188981879-188981901 TTTTTCAGCAAAGGTAACTAAGG + Intronic
943551421 2:189345028-189345050 ATGTGCTGCAAAAGGAATTAGGG + Intergenic
943867173 2:192940632-192940654 ATCTTTAGTGAAAGGAAATAGGG + Intergenic
943888433 2:193253467-193253489 ATCTTGAGGAAAAGGTACTTAGG - Intergenic
944159989 2:196649079-196649101 ATCTTGAGCAAAAATAACAAAGG - Intronic
944800797 2:203236093-203236115 AAGTTCAGAAAAAGGAACCATGG + Intergenic
946982931 2:225237978-225238000 ATTCTCAGTGAAAGGAACTAAGG + Intergenic
947375163 2:229488653-229488675 AACTTCATCAAAAGGAAAGAAGG - Intronic
947683818 2:232062668-232062690 ATCTCCATTAAAAGGAACTAGGG - Intronic
948038703 2:234881232-234881254 TTCCTGAGCAAAAAGAACTAAGG - Intergenic
948327489 2:237137716-237137738 ATCTCCAGTTAAAGGAACCAGGG - Intergenic
948477918 2:238232417-238232439 ATCATCTGCAAATGGAACAAAGG - Intergenic
1169418316 20:5437178-5437200 TTCTTCAGTAAAAGGAAGCAAGG - Intergenic
1169692903 20:8353069-8353091 TTCTTCAATAAAAGGAACTAGGG + Intronic
1169893256 20:10475627-10475649 ATCTTCTGCAACATGAACAAAGG - Intronic
1170578918 20:17683362-17683384 TTCTGCAGCAACAGGAGCTAGGG - Intergenic
1170614467 20:17937717-17937739 GTCCTCAGCTAAAGGAACAAAGG - Intergenic
1170781081 20:19425984-19426006 TTCCTCACTAAAAGGAACTAGGG - Intronic
1172936082 20:38621378-38621400 ATCTCCATCAAAAGGAAATGGGG + Intronic
1173074201 20:39801239-39801261 ATCTTATGGAAAAGGAACCAAGG + Intergenic
1173356364 20:42295492-42295514 AACTTCAGCAAAAGGACTGATGG + Intronic
1173503139 20:43567696-43567718 GTCATCGGCAAAGGGAACTACGG + Exonic
1173865496 20:46309773-46309795 ATCATCAGCAAGACGGACTAGGG - Intergenic
1174433934 20:50491839-50491861 ATCATCAGCAAGAGGCACAAGGG - Intergenic
1174687110 20:52466592-52466614 ATATTCAGAAAAAGGATCTTTGG - Intergenic
1180602173 22:17028820-17028842 ATCTTAAGCCAAAAGAACAAAGG + Intergenic
1181917353 22:26291966-26291988 GTCTTCAGGAAAAGGAAGGAAGG + Intronic
1181986936 22:26806495-26806517 ATCTTCAGCAAAGGGGGCTGTGG - Intergenic
1183353328 22:37345398-37345420 ATGTTATGCATAAGGAACTAAGG - Intergenic
949109496 3:241810-241832 CTCTTAAGTAAAAGAAACTAAGG + Intronic
949165203 3:932180-932202 ATATTGAGCAAAAGCAAATATGG - Intergenic
949261999 3:2113850-2113872 ATCTTCAGCATAAGGAAGAATGG - Intronic
949477032 3:4457445-4457467 ATTTTGAGCAAAAAGAACAAAGG + Intronic
949642336 3:6051465-6051487 ATGTTGAGCAAAAAGAACAAAGG + Intergenic
950402822 3:12783305-12783327 TTCTCCAGTAAAAGGAACCAGGG + Intergenic
951223032 3:20089172-20089194 ATCTTGAGCAAAAAGAACAAAGG - Intronic
951957330 3:28271641-28271663 ATCCTAAGCAAAAAGAACAAAGG - Intronic
951977422 3:28528264-28528286 ATCCTAAGCAAAAAGAACAAAGG - Intronic
952349736 3:32522590-32522612 ATGTACAGTAAAAGGAACTCTGG - Intergenic
954769906 3:52957512-52957534 ATCCTAAGCAAAAAGAACAAAGG + Intronic
956102724 3:65785469-65785491 AACTTCAGTAACAGAAACTACGG + Intronic
956256516 3:67289002-67289024 TTCTCCAGCAAAGGGAACCAGGG - Intergenic
958543175 3:95507322-95507344 ATCTTCAGCAAAATACACTGGGG - Intergenic
958591171 3:96159952-96159974 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
959118274 3:102203792-102203814 ATCTTCACTAAAAGGAACAGAGG - Intronic
959256611 3:104023244-104023266 ATCTTAAGCAAATAGAACAAAGG + Intergenic
959794694 3:110411726-110411748 ATCTTCAGTAAAATAAAATAAGG - Intergenic
960821297 3:121735867-121735889 ATCTCCAATAAAAGGAACTAGGG + Intronic
961901608 3:130218292-130218314 ATCTGGAGAAAAAGGAAATAGGG + Intergenic
962994252 3:140609921-140609943 ATCCTAAGCAAAAAGAACTAAGG + Intergenic
963220257 3:142801662-142801684 CACTTCAGCAAAAGAAATTAGGG + Intronic
963617925 3:147567127-147567149 ATCTTAAGCAAAAAGAACAAAGG + Intergenic
964253928 3:154752546-154752568 ATCTTCACCAAAAGGAAGACAGG + Intergenic
964748195 3:160031223-160031245 ATCTTCAGCAAAAGGAACTATGG + Intronic
965164627 3:165180883-165180905 ATCTTCAACAAAAAGGACAATGG - Intergenic
965207197 3:165736484-165736506 ATCAACAGCAAAAGGAACTTTGG + Intergenic
965452207 3:168852048-168852070 ATCCTGAGCAAAAGGAACAAAGG - Intergenic
967651966 3:191996720-191996742 TTCTTCAGCAAAAAGAAAAATGG + Intergenic
968335441 3:197908980-197909002 ATCTTCAGGCAAAGGAAGTGCGG + Intronic
969140791 4:5069882-5069904 TTCTTCAGCAGAAGAAACTGAGG - Intronic
970678510 4:18480085-18480107 ATTTTCAGGAAATGGAAGTAAGG - Intergenic
970772137 4:19626557-19626579 ATTTTAAGCAAAAAGAACAAAGG - Intergenic
970783951 4:19773297-19773319 ACTTTCAAAAAAAGGAACTATGG - Intergenic
970868718 4:20788663-20788685 ATCTTCAGCAAATGAAAATAAGG + Intronic
971061249 4:22973059-22973081 ATCCTGAGCAAAAAGAACAAAGG - Intergenic
972048074 4:34694077-34694099 ACCTTCCCCAAAAGGAATTATGG - Intergenic
972266075 4:37461260-37461282 ATCCTCAGCAGAAAGAACAAAGG - Intronic
972395366 4:38654731-38654753 CTCTTCAGAAATAGGAACTTCGG + Intergenic
973012276 4:45091952-45091974 ATGCACAGCAAAAGAAACTATGG + Intergenic
974116888 4:57589942-57589964 ATCTTTATCAAATGGAAATACGG + Intergenic
974150965 4:58008708-58008730 ATCCTAAGCCAAAGGAACAAAGG - Intergenic
976890732 4:90044116-90044138 GTCTCCAGCAAAAAGAAATATGG - Intergenic
977508341 4:97930622-97930644 ATCCTAAGCAAAAAGAACAAAGG - Intronic
978025199 4:103864897-103864919 ATCCTAAGCAAAAAGAACTGGGG - Intergenic
978343970 4:107746594-107746616 ATTTCCAACAAAAGGAACCAGGG + Intergenic
978530805 4:109711337-109711359 TTCTCCAACAAAAGGAACCAGGG + Exonic
978929327 4:114291710-114291732 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
979458161 4:120949761-120949783 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
979563609 4:122128572-122128594 ATCTTCATCAAAACAAAATATGG - Intergenic
981567838 4:146119316-146119338 TTCTTCAATAAAAGGAACTAGGG + Intergenic
981901022 4:149863662-149863684 ATCCTGAGCAAAAAGAACAAAGG + Intergenic
983119505 4:163863722-163863744 TTCTCCAGTAAAAGGAACCAGGG + Intronic
984133150 4:175903066-175903088 ATCTTCACTAAAAGAAACCACGG + Intronic
985810636 5:2081754-2081776 TTCTCCAGTAAAAGGAACCAGGG + Intergenic
985827458 5:2203600-2203622 ATCATCTGGAAAGGGAACTAAGG - Intergenic
987290987 5:16508100-16508122 ATTTTCAACAATAGGAACTGTGG + Intronic
987394563 5:17410079-17410101 TTCTTCAGTCAAAGGAACCAGGG - Intergenic
987682545 5:21156447-21156469 ATGTTGAGCAAAAAGAACAAAGG + Intergenic
987693654 5:21300464-21300486 ATGTTCTGCAAAAGCAACCATGG - Intergenic
988048123 5:25986355-25986377 ATCTTGAGAAATAGGAACAAAGG - Intergenic
989630140 5:43473811-43473833 ATCCTAAGCAAAAGGAACAAAGG + Intronic
989806858 5:45619312-45619334 TTCTTCAACAAAAATAACTATGG + Intronic
991746615 5:69749082-69749104 ATGTTCTGCAAAAGCAACCATGG + Intergenic
991751090 5:69806160-69806182 ATGTTCTGCAAAAGCAACCATGG - Intergenic
991798217 5:70329025-70329047 ATGTTCTGCAAAAGCAACCATGG + Intergenic
991825993 5:70624394-70624416 ATGTTCTGCAAAAGCAACCATGG + Intergenic
991830377 5:70681055-70681077 ATGTTCTGCAAAAGCAACCATGG - Intergenic
991890553 5:71328341-71328363 ATGTTCTGCAAAAGCAACCATGG + Intergenic
992957107 5:81921303-81921325 ATATTAAGCAAAAAGAACAAAGG - Intergenic
993140031 5:84020298-84020320 ATATTCACCCAAAGGAAATATGG + Intronic
993450258 5:88064627-88064649 ATCAATAGCAAAAGGAACTTTGG + Intergenic
994384744 5:99117820-99117842 ATCTCCACAAAAAGGAACTAGGG - Intergenic
995151914 5:108857961-108857983 TTCTCCACTAAAAGGAACTAGGG - Intronic
995167827 5:109067350-109067372 ATCTTCAAGAAGAGAAACTAAGG - Intronic
995299238 5:110558469-110558491 GTCTTCAGGCAAAGGAGCTATGG + Intronic
995396026 5:111688088-111688110 ATATTCAGAGAAAGGTACTAAGG - Intronic
995524738 5:113041470-113041492 ATATTCTGCAAAAGGAAGAAGGG + Intronic
996515310 5:124362936-124362958 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
996641989 5:125766234-125766256 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
997679316 5:135738173-135738195 ATCTTGAGCAAAATGATGTAAGG + Intergenic
997689207 5:135814260-135814282 ATCTTCAGGGAATGGATCTAAGG - Intergenic
998170178 5:139868216-139868238 ATCCTCAGCAAACAGGACTAAGG - Intronic
1000273831 5:159714205-159714227 ATCTACAGCAGAAAGAACTACGG + Intergenic
1001594538 5:172889453-172889475 TTCTTCAATAAAAGGAACCATGG + Intronic
1002161047 5:177314326-177314348 ATTTTCAGCAAAGGGAAAGAAGG + Intergenic
1002688016 5:181030082-181030104 ATCTTGAGCAAATAGAACCAAGG + Intergenic
1002768637 6:267538-267560 TTCTTCAACAAAAGGAGCCAGGG + Intergenic
1002943377 6:1737150-1737172 ATTTTCAGTAAAAGTAACAAGGG - Intronic
1003027383 6:2567547-2567569 ATCTCCAACAAAAGGAAACAGGG - Intergenic
1004484572 6:16053896-16053918 ATCTTTAGTAAAAGGAACTTTGG + Intergenic
1005152982 6:22774005-22774027 ATCTTCAGTTAAAGCAATTATGG + Intergenic
1005654999 6:27926836-27926858 ATTTCCAGTAAAAGGAACCAAGG - Intergenic
1006016551 6:31085840-31085862 ATTTTCAGGAAAAGAAAGTAGGG + Intergenic
1006540408 6:34735439-34735461 TTCTCCAACAAAAGGAACCAGGG - Intergenic
1007101944 6:39254753-39254775 CTCTTCACAAAAAGGAACCAGGG - Intergenic
1007863348 6:44938305-44938327 CTCTTCAGAAAAAGGAGCTGGGG - Intronic
1008320378 6:50104730-50104752 ATCTCCAGCAAATGGGTCTAGGG + Intergenic
1009892502 6:69704635-69704657 AACTTCATTAAAAGGAACCAGGG - Intronic
1009899848 6:69797311-69797333 TTCTTCACCAAAAGGAAGTTTGG + Intergenic
1009989916 6:70829516-70829538 TTATTCAGCAAAAGGCACCATGG + Intronic
1010669097 6:78665657-78665679 ATTTTCAATAAAAGGAACCATGG + Intergenic
1012098848 6:95003861-95003883 ATCTTCAGAGAAATGCACTAAGG - Intergenic
1012161960 6:95896933-95896955 AACTTCAGCAAAAGGAATGATGG - Intergenic
1012619215 6:101319213-101319235 ATCTTTAACAAAAGGAGCAAAGG - Intergenic
1012799469 6:103806532-103806554 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
1012854265 6:104482980-104483002 AGCTTCTGCAAAAGGAATTTTGG - Intergenic
1013296622 6:108763467-108763489 TGCTTCAGCAAAAGAAACTGTGG + Intergenic
1013386820 6:109640092-109640114 ATCCTAAGCAAAAAGAACAAAGG - Intronic
1013896786 6:115098618-115098640 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1013943989 6:115700680-115700702 ATCTTAAGCAAAAAGAACAAAGG - Intergenic
1014542186 6:122690330-122690352 ATCTTCACTAAAAGGAACGCAGG - Intronic
1014561206 6:122892912-122892934 ATCCTAAGCAAAAGGAGCAAAGG - Intergenic
1014942397 6:127457977-127457999 ATGTTTAGCAAAAGGAAATAAGG - Intronic
1015160571 6:130148545-130148567 TTCTTCATGAAAAGGAATTAGGG - Intronic
1015327131 6:131935812-131935834 ATGTCCAATAAAAGGAACTAGGG - Intergenic
1016094889 6:140023046-140023068 AATTTCAGCAAATGGAAATATGG + Intergenic
1016283441 6:142446676-142446698 ATCTACAGTAAAAGGAAGTGGGG - Intergenic
1016314503 6:142771331-142771353 CTCTTCAGCAAGAGGACCCAGGG - Exonic
1016526242 6:145004713-145004735 ATTGTGAGCAAAAGGAACTTGGG - Intergenic
1016601901 6:145871743-145871765 ATCCTTAGCAAAAAGAACAAAGG + Intronic
1016697299 6:147012293-147012315 TTCTTCAATAAAAGGAATTAGGG + Intergenic
1016819256 6:148332365-148332387 AATTTCAGCAGCAGGAACTATGG + Intronic
1017678835 6:156843124-156843146 TTCTTCAGAAAAAGGAAATGGGG - Intronic
1018505576 6:164464265-164464287 GCCTTCACCAAAAGGACCTATGG - Intergenic
1019091770 6:169541657-169541679 ATTTTCAGCAAAAGGACTGATGG + Intronic
1019938530 7:4271647-4271669 AAGTTCAGCAAAAGGAACTTAGG - Intergenic
1020523918 7:9232975-9232997 ACCTTCAGCAAATGGAGCTCAGG - Intergenic
1021470839 7:21000979-21001001 TTTTCCAGCTAAAGGAACTAAGG + Intergenic
1022285330 7:28951517-28951539 ATCCTAAGCAAAAAGAACCAAGG + Intergenic
1022869838 7:34464674-34464696 TTTTCCAGTAAAAGGAACTAGGG - Intergenic
1023500974 7:40849027-40849049 ATTTTCAGCAAAATGAAGTTTGG + Intronic
1024305991 7:47929978-47930000 ATTTGCAGCACAAGGAGCTAGGG - Intronic
1024515248 7:50246230-50246252 ATCAAAAGCAAAAGGAAATAGGG + Intergenic
1024614049 7:51092730-51092752 ATCTTGAGCAAAAAGAACAAAGG - Intronic
1025001381 7:55317966-55317988 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1025070780 7:55896781-55896803 TTCTCCAGTAAAAGGAACCAGGG + Intronic
1025073285 7:55920136-55920158 TTCTTCACTAAAAGGAACCAGGG + Intronic
1027337556 7:77169825-77169847 TTCTCCAGTAACAGGAACTAGGG - Intronic
1027518006 7:79166690-79166712 ATCTTTAGCAAATGAAAATATGG + Intronic
1028553640 7:92099500-92099522 ATATTAAGCAAAAGGCACGAAGG - Intronic
1028580349 7:92403459-92403481 ATATTCTGAAAAAGGAACCATGG + Intergenic
1028986028 7:97008712-97008734 ATCTTCAGCAAGGGGACCTCAGG + Intronic
1029778184 7:102700977-102700999 TTCTCCAGTAACAGGAACTAGGG + Intergenic
1029928222 7:104341699-104341721 GTCTTCAGCAAAGTGAACTGGGG - Intronic
1030679284 7:112417678-112417700 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
1030814569 7:114019969-114019991 ATCTTTGGGTAAAGGAACTATGG + Intronic
1030980946 7:116185287-116185309 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
1031523564 7:122796411-122796433 ACCTTAAGCAAAATGAACAAAGG + Intronic
1036435999 8:8733938-8733960 TTCTCCAATAAAAGGAACTAGGG - Intergenic
1036479253 8:9123676-9123698 CTCTCCATGAAAAGGAACTAAGG - Intergenic
1036783592 8:11670047-11670069 ATCTTAAGCAAAAAGAACAAAGG - Intergenic
1038859503 8:31371600-31371622 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1039192135 8:34988270-34988292 TTCTTCAATAAAAGGAAGTAAGG - Intergenic
1039772012 8:40697016-40697038 TACTTCATCGAAAGGAACTAGGG + Intronic
1039876278 8:41589326-41589348 GCATTCAGCAAAAGGAACTCGGG + Intronic
1040777871 8:51069195-51069217 ACCTTCAGCAAAAGGAAGCAAGG + Intergenic
1040817192 8:51520567-51520589 AGCTCCAGGAACAGGAACTATGG + Intronic
1041183564 8:55274060-55274082 ATCTTCAGCAAACTGAAATCAGG + Intronic
1041218698 8:55627435-55627457 ATGTTCAGCAAACGGGACCACGG + Intergenic
1043079466 8:75747827-75747849 ATCTTGTGCAAAAGGATGTATGG + Intergenic
1043675681 8:82949638-82949660 ATCTTCAATAAAAGGAACATGGG + Intergenic
1044765494 8:95568577-95568599 ATCTTAAGCAAGAAGAACAAAGG - Intergenic
1045337936 8:101224758-101224780 ATCTTCGGGAAAAGCAACTGTGG - Intergenic
1045560119 8:103253754-103253776 ATCTGAGGCAATAGGAACTAGGG + Intergenic
1045753769 8:105517155-105517177 ATTTTCAGTAAACGGAAGTAGGG + Intronic
1046162628 8:110387338-110387360 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1046619954 8:116518480-116518502 ATCTTCAGCAAATAGAAGAATGG + Intergenic
1046834019 8:118779332-118779354 ATATTCAACAAAAGCAATTAAGG + Intergenic
1047276846 8:123412116-123412138 ATCTTCAGCCACGCGAACTAGGG + Intronic
1047363806 8:124194092-124194114 ATTTTCAGCCAATAGAACTAAGG + Intergenic
1048715824 8:137268249-137268271 TTCTTCAATAAAAGGAACCAAGG + Intergenic
1050037456 9:1452232-1452254 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1050179955 9:2911140-2911162 ATCTTCATCAGAAGTAATTATGG - Intergenic
1050395013 9:5186308-5186330 ATCTCCAGAAAAAAGAAGTAGGG + Intergenic
1050800832 9:9611133-9611155 ATATTCAACAGAAGGAATTATGG - Intronic
1050811587 9:9754848-9754870 ATCTTCAATAAAAGGTGCTAAGG + Intronic
1051493040 9:17688535-17688557 TCCTTCAGTAAAAGGAACCAGGG + Intronic
1051715454 9:19978270-19978292 ATCTTTAGCAAAAGGACAGAGGG + Intergenic
1055412012 9:76040709-76040731 ATGTTCAGAAAAAGCATCTAGGG - Intronic
1055737377 9:79346131-79346153 ATCTTCAGGAAAAGGAAAGAAGG + Intergenic
1055981235 9:82003544-82003566 TTCTCCAGCAAATGGAACTAGGG - Intergenic
1056473080 9:86924879-86924901 ATCCTCAACAATAGGCACTAGGG + Intergenic
1057404110 9:94752198-94752220 TTCTTCACCAAAAGGAATTGTGG + Intronic
1057460734 9:95259237-95259259 ATCCTAAGCAAAAAGAACAAAGG + Intronic
1057841939 9:98493320-98493342 TTCTCCAGTAAAAGGAACCAGGG - Intronic
1057971257 9:99560327-99560349 ATCTTTTGCTAAAGGAATTATGG + Intergenic
1058655103 9:107213133-107213155 ATCTCCAGCAAATGAAGCTACGG + Intergenic
1058944006 9:109840061-109840083 ATCTTAAGCCAAAAGAACAAAGG + Intronic
1059089499 9:111340785-111340807 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
1059631428 9:116127601-116127623 TTCTTAAGCAAAAAGAACAAAGG - Intergenic
1062531183 9:137001133-137001155 ATCTTCCCTAAAAGGAACCAGGG + Intergenic
1185747846 X:2585828-2585850 ACCTTCAGAAACAGGAACAAAGG + Intergenic
1187105472 X:16237113-16237135 ATCTTCCATAAAAGGAATTATGG + Intergenic
1187643985 X:21326723-21326745 ATCTTCACAAAAAGGAAGGAAGG + Intergenic
1187804049 X:23098734-23098756 ATCCTAAGCAAAAAGAACAAAGG + Intergenic
1188052087 X:25500038-25500060 ATCTCCACAAAAAGGAACCAAGG - Intergenic
1188227079 X:27612893-27612915 ATCCTCAGCAAAAACAACAAAGG - Intronic
1188266453 X:28081859-28081881 ATCCTGAGCAAAAAGAACAAAGG + Intergenic
1188381698 X:29501756-29501778 ATCCTGAGCAAAATGAACAAAGG - Intronic
1188402203 X:29759419-29759441 ATCTCCAAAAAAAAGAACTATGG - Intronic
1188681125 X:33006886-33006908 AGCTTGAGCAAAAGGAAGGATGG - Intronic
1191565423 X:62521658-62521680 ATCTTAAGCCAAAAGAACAAAGG + Intergenic
1192388264 X:70696398-70696420 ATCATTTACAAAAGGAACTAAGG + Intronic
1192877253 X:75244463-75244485 ATCTTAAGCAAAAAGAAAAAAGG + Intergenic
1193018515 X:76763321-76763343 ATCTTAAGCAAAAAGAATAAAGG + Intergenic
1193512877 X:82427503-82427525 ATCTGAAGCAAAAAGAACAAAGG - Intergenic
1193858669 X:86637959-86637981 ATCCTAAGCAAAAAGAACAAGGG + Intronic
1194361178 X:92952456-92952478 TTCTTCAACAAAAAGAACTGAGG + Intergenic
1194514921 X:94840645-94840667 ATCCTAAGCAAAAAGAACAAAGG - Intergenic
1195140535 X:101954879-101954901 ATCCTAAGCAAAAAGAACAAGGG + Intergenic
1196011271 X:110890417-110890439 ATCCTAAGCAAAAGGAACAAAGG + Intergenic
1198597722 X:138255153-138255175 ACCTTCAGGAAAAGGAATTCAGG - Intergenic
1198721035 X:139620911-139620933 ATCATAAGCAAAAAGAACAAGGG + Intronic
1198806119 X:140496660-140496682 TTCTTCAATAAAAGGAACCAGGG - Intergenic
1199274011 X:145921422-145921444 ATCTTCAGCTAAAGGAATACTGG - Intergenic
1200669373 Y:6068285-6068307 TTCTTCAACAAAAAGAACTGAGG + Intergenic
1201892848 Y:18961717-18961739 ATCCTAAGCAAAAAGAACAAAGG + Intergenic