ID: 964748257

View in Genome Browser
Species Human (GRCh38)
Location 3:160031798-160031820
Sequence GGCTGAAGTTCCCGAGTGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 547
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 531}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964748257_964748265 30 Left 964748257 3:160031798-160031820 CCAGCCACTCGGGAACTTCAGCC 0: 1
1: 0
2: 1
3: 14
4: 531
Right 964748265 3:160031851-160031873 CATGCCACTGCACTCCAGCCTGG 0: 28465
1: 91631
2: 178015
3: 198511
4: 164335
964748257_964748260 -10 Left 964748257 3:160031798-160031820 CCAGCCACTCGGGAACTTCAGCC 0: 1
1: 0
2: 1
3: 14
4: 531
Right 964748260 3:160031811-160031833 AACTTCAGCCCAGGAGCTCAAGG 0: 1
1: 6
2: 260
3: 4507
4: 15754

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964748257 Original CRISPR GGCTGAAGTTCCCGAGTGGC TGG (reversed) Intergenic
900242864 1:1625227-1625249 GGCTGAAGTCCCAGAGGGGAGGG + Intronic
901233185 1:7652481-7652503 GGCAGAAGCTCCCGAGTCCCTGG - Intronic
901585240 1:10284745-10284767 GCCTCAGCTTCCCGAGTGGCTGG - Intronic
901591622 1:10348888-10348910 GCCTCAGGTTCCCGAGTAGCTGG + Intronic
902858859 1:19230031-19230053 CTCTGAAGTTCACGAGGGGCTGG - Intronic
903074330 1:20750930-20750952 GCCTCAACTTCCCGAGTAGCTGG + Intronic
903454620 1:23478643-23478665 GCCTCAACTTCCCGAGTAGCTGG - Intronic
903505118 1:23828509-23828531 GCCTCAGGTTCCCGAGTAGCTGG + Intronic
903554022 1:24180422-24180444 GGATGAAATTCTCAAGTGGCTGG - Intronic
903798290 1:25946950-25946972 GTCTCAACTTCCCGAGTAGCTGG + Intergenic
904197582 1:28797240-28797262 GGCGGAAGTGGCCAAGTGGCAGG - Intergenic
904249666 1:29214174-29214196 GCCTCAACTTCCCGAGTAGCTGG + Intronic
904651421 1:32008826-32008848 GCCTCAGGTTCCCGAGTAGCTGG + Intergenic
904985037 1:34538807-34538829 GGCTGAACTTTCAGAGAGGCAGG + Intergenic
906331192 1:44886192-44886214 GCCTCAAGCTCCCGAGTAGCTGG + Intronic
906384758 1:45358196-45358218 GCCTCAACTTCCCGAGTAGCTGG - Intronic
906638039 1:47423097-47423119 GCCTCAAGCTCCCGAGTAGCTGG - Intergenic
906965053 1:50448235-50448257 GGTTTGAGTTCCCCAGTGGCTGG + Intronic
907112381 1:51937610-51937632 GCCTCAGCTTCCCGAGTGGCTGG + Intronic
907164490 1:52398376-52398398 GGCTCAACCTCCCGAGTAGCTGG + Intronic
907258439 1:53197571-53197593 GGCTGAGGGTCCTGAGTGACAGG - Intronic
907323744 1:53621923-53621945 GCCTCAGCTTCCCGAGTGGCTGG + Intronic
907520819 1:55022274-55022296 GGCTGCTGCTCCAGAGTGGCCGG + Intergenic
908357371 1:63336137-63336159 ATCTCAACTTCCCGAGTGGCTGG + Intergenic
908955487 1:69621157-69621179 GTCTCAGGTTCCCGAGTAGCTGG + Intronic
910677274 1:89827233-89827255 GCCTCAACTTCCCGAGTAGCTGG - Intronic
910842971 1:91578479-91578501 GGAGGAAGTTCCAGAGAGGCAGG - Intergenic
912347632 1:108979409-108979431 GCCTTAGCTTCCCGAGTGGCTGG - Intronic
912798123 1:112705108-112705130 GGCTGAAGTTCCCAGGCTGCAGG + Exonic
912818035 1:112845255-112845277 GCCTCAGGTTCCCGAGTAGCTGG + Intergenic
913613821 1:120535840-120535862 GCCTGAGGCTCCCGAGTAGCTGG + Intergenic
914226978 1:145728616-145728638 GGCTCAGCTTCCCGAGTAGCTGG + Intronic
914576448 1:148975054-148975076 GCCTGAGGCTCCCGAGTAGCTGG - Intronic
914713110 1:150233148-150233170 GCCTCAACTTCCCGAGTAGCTGG - Intronic
914734930 1:150406827-150406849 GGCTCAACTTCCCGAGTAGCTGG + Intronic
915426355 1:155830390-155830412 GGCTCAGCCTCCCGAGTGGCTGG + Intronic
915829366 1:159111925-159111947 GCCTCAAATTCCCAAGTGGCTGG - Intronic
916211134 1:162360862-162360884 GGCTGAAGTTAGGGAGTAGCAGG - Intronic
916216645 1:162400832-162400854 GGCTCAACCTCCCGAGTAGCTGG - Intronic
917022474 1:170603926-170603948 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
917349722 1:174064356-174064378 GCCTCAGCTTCCCGAGTGGCTGG + Intergenic
918341548 1:183572071-183572093 GGCTAAAGTTGCCCAGTGGTCGG - Intronic
919020762 1:192102036-192102058 GCCTCAACTTCCCGAGTAGCTGG - Intergenic
919366929 1:196673449-196673471 GCCTCAACTTCCCGAGTAGCTGG + Intronic
920177112 1:204108871-204108893 GTCTGAAGTTCCTGAGAGGAAGG + Intronic
920391134 1:205602980-205603002 GTCTGATGTTCCCCAGAGGCAGG + Intronic
921710438 1:218368257-218368279 GCCTGAATCTCCCGAGTAGCTGG + Intronic
922932369 1:229400248-229400270 GCCTCAACTTCCCGAGTGGCTGG + Intergenic
924109379 1:240683223-240683245 GCCTCAGCTTCCCGAGTGGCTGG + Intergenic
924207942 1:241733358-241733380 GCCTGAGCTTCCCGAGTAGCTGG - Intronic
924355694 1:243173173-243173195 GCCTCAGCTTCCCGAGTGGCTGG + Intronic
924811200 1:247403959-247403981 GCCTCAAGCTCCCGAGTAGCTGG + Intergenic
1063226575 10:4020409-4020431 GCCTCAACTTCCCGAGTAGCTGG - Intergenic
1063672280 10:8109035-8109057 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1065194855 10:23254320-23254342 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1065202184 10:23323795-23323817 GGTTCAAGCTCCCAAGTGGCTGG - Intronic
1065402767 10:25324951-25324973 GCCTCAACTTCCCGAGTAGCTGG + Intronic
1065433198 10:25680791-25680813 GGCTCAAGTTCCCATGTAGCTGG + Intergenic
1065469744 10:26065468-26065490 GCCTCAGCTTCCCGAGTGGCTGG - Intronic
1065568890 10:27047504-27047526 GCCTCAACTTCCCGAGTAGCTGG - Intronic
1065658487 10:27979093-27979115 GCCTCAAGCTCCCGAGTAGCTGG - Intronic
1065909739 10:30291799-30291821 GCCTCAACCTCCCGAGTGGCTGG + Intergenic
1065929915 10:30470376-30470398 GGCTCAGCTTCCCGAGTAGCTGG - Intergenic
1066271979 10:33832988-33833010 GCCTCAACTTCCCGAGTAGCTGG - Intergenic
1066400592 10:35072481-35072503 GCCTGAACCTCCCGAGTAGCTGG + Intronic
1066410750 10:35166612-35166634 GCCTCAAACTCCCGAGTGGCTGG - Intronic
1066590715 10:36991073-36991095 GCCTCAGGCTCCCGAGTGGCTGG - Intergenic
1067377217 10:45738817-45738839 GGCTCAGCTTCCCGAGTAGCTGG + Intronic
1067884434 10:50074799-50074821 GCCTCAAGCTCCCGAGTAGCTGG - Intronic
1067884924 10:50079509-50079531 GGCTCAGCTTCCCGAGTAGCTGG + Intronic
1068350967 10:55844616-55844638 GCCTCAACTTCCCGAGTAGCTGG - Intergenic
1070104332 10:73417091-73417113 GGCTGAACCTCCCAAGTAGCTGG + Intergenic
1070260117 10:74846551-74846573 GCCTTAACTTCCCGAGTAGCTGG + Intronic
1071580219 10:86762471-86762493 GGCTCAGCTTCCCGAGTAGCTGG + Intronic
1072295808 10:94008709-94008731 TGCTGAAGTGCCCCAGAGGCTGG + Intronic
1073367151 10:102952447-102952469 GGCTCAGCTTCCCGAGTAGCTGG - Intronic
1073503211 10:103961575-103961597 GCCTCAAGCTCCCGAGTAGCTGG + Intergenic
1073677303 10:105662488-105662510 GCCTGAACCTCCCGAGTAGCTGG - Intergenic
1073924586 10:108500560-108500582 GGCTGTATTTCCTGAGTTGCAGG - Intergenic
1074718333 10:116241584-116241606 GGCTGAAGTTCCACTTTGGCAGG + Intronic
1075449768 10:122542794-122542816 GCCTCAGGTTCCTGAGTGGCTGG + Intergenic
1075919102 10:126195458-126195480 GTCTCAACTTCCCGAGTAGCTGG - Intronic
1076370603 10:129950298-129950320 GGCTGTGGTGCCCGAGTGGATGG - Intronic
1076761121 10:132606221-132606243 GGCTGAGGGTCCTCAGTGGCGGG + Intronic
1078887104 11:15512356-15512378 GGCTGAGCCTCCCGAGTAGCTGG - Intergenic
1078972985 11:16436598-16436620 GCCTGAAGTTGCCGAGTTGGTGG - Intronic
1079051362 11:17163189-17163211 GGCTCAGCTTCCCGAGTAGCTGG - Intronic
1079199534 11:18363957-18363979 GTCTCAACTTCCCGAGTAGCTGG - Intronic
1080424559 11:32144137-32144159 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1080432712 11:32213412-32213434 GGCTGAGGCTCTCGAGGGGCTGG + Intergenic
1080542607 11:33282566-33282588 GCCTCAGCTTCCCGAGTGGCTGG - Intronic
1080550868 11:33373252-33373274 GCCTTAGGCTCCCGAGTGGCTGG + Intergenic
1080703781 11:34668938-34668960 GCCTCAGCTTCCCGAGTGGCTGG + Intergenic
1081466599 11:43324790-43324812 GCCTCAACTTCCCGAGTAGCTGG + Intronic
1082277889 11:50241422-50241444 GCCTCAGCTTCCCGAGTGGCTGG + Intergenic
1082660924 11:55910183-55910205 GCCTCAACTTCCCGAGTAGCTGG - Intergenic
1083347703 11:62005083-62005105 GCCTCAACCTCCCGAGTGGCTGG - Intergenic
1084256545 11:67946790-67946812 GGCTCAGCTTCCCGAGTAGCTGG + Intergenic
1084816235 11:71648553-71648575 GGCTCAGCTTCCCGAGTAGCTGG - Intergenic
1085199895 11:74695624-74695646 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1086056352 11:82652091-82652113 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1086113755 11:83225663-83225685 GCCTGAACCTCCCGAGTAGCTGG - Intronic
1086126962 11:83358900-83358922 GCCTCAACCTCCCGAGTGGCTGG + Intergenic
1087848371 11:102999547-102999569 GCCTCAGCTTCCCGAGTGGCTGG + Intergenic
1089386233 11:118069944-118069966 GCCTCAACCTCCCGAGTGGCTGG - Intergenic
1089502875 11:118942728-118942750 GGCTCAGCTTCCCGAGTAGCTGG + Intronic
1090028375 11:123186635-123186657 GCCTCAAGCTCCCGAGTAGCTGG + Intronic
1090062491 11:123476213-123476235 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1090099635 11:123780513-123780535 GCCTCAACTTCCCGAGTAGCCGG - Intergenic
1090536520 11:127647753-127647775 GCCTCAGGTTCCCGAGTAGCTGG + Intergenic
1091227111 11:133964220-133964242 GCCTCAACTTCCCGAGTAGCTGG - Intergenic
1091390664 12:124272-124294 GCCTCAGCTTCCCGAGTGGCTGG - Intronic
1091735857 12:2921252-2921274 GCCTCAACTTCCCGAGTAGCTGG + Intronic
1091939253 12:4461454-4461476 GCCTCAAGCTCCCGAGTAGCTGG - Intergenic
1092374247 12:7942171-7942193 GGCTCAGCTTCCCGAGTAGCTGG - Intergenic
1092426760 12:8381490-8381512 GGCTCAGCTTCCCGAGTAGCTGG + Intergenic
1093966660 12:25334313-25334335 GCCTCAGCTTCCCGAGTGGCTGG + Intergenic
1094588797 12:31801693-31801715 GCCTCAACTTCCCGAGTAGCTGG - Intergenic
1094681099 12:32667901-32667923 GCCTGAGCTTCCCGAGTAGCTGG + Intergenic
1096317138 12:50577417-50577439 GCCTCAGCTTCCCGAGTGGCTGG - Intronic
1098253692 12:68594980-68595002 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1098907050 12:76172918-76172940 GCCTCAGGCTCCCGAGTGGCTGG - Intergenic
1100841080 12:98612343-98612365 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1101952910 12:109190201-109190223 GGCTCAGCTTCCCGAGTAGCTGG + Intronic
1102217270 12:111170312-111170334 GCCTCAACTTCCCGAGTAGCTGG - Intronic
1102955806 12:117058103-117058125 GTCTGAGGTTCCCAAGTAGCTGG - Intronic
1103089578 12:118088128-118088150 GCCTTAGGTTCCCGAGTAGCTGG - Intronic
1103198528 12:119067591-119067613 GCCTGAACCTCCCGAGTAGCTGG - Intronic
1105011026 12:132756814-132756836 GCCTCAGGTTCCCGAGTAGCTGG - Intronic
1105560042 13:21481736-21481758 GGCTTAGCTTCCCGAGTAGCTGG - Intergenic
1106958700 13:34973232-34973254 GGCTGGAGATCCTGACTGGCAGG + Intronic
1107503956 13:41011840-41011862 ACCTCAAGTTCCCAAGTGGCTGG + Intronic
1107525333 13:41225095-41225117 GCCTCAGCTTCCCGAGTGGCTGG - Intronic
1108888726 13:55226119-55226141 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1109589864 13:64463680-64463702 GCCTCAGCTTCCCGAGTGGCTGG + Intergenic
1112012475 13:95303585-95303607 GCCTGAGGTTCCTGAGTAGCTGG - Intergenic
1112547383 13:100384138-100384160 GGCTCAGCTTCCCGAGTAGCTGG + Intronic
1112677597 13:101721504-101721526 GGCTCATGTTGCCCAGTGGCTGG - Exonic
1112751263 13:102586278-102586300 GCCTCAATTTCCCGAGTAGCTGG + Intergenic
1115061901 14:29202219-29202241 GGCTGAAATTCTAGAGTTGCTGG + Intergenic
1115514712 14:34173896-34173918 GGCTGAAATGCCCCAGTGGTTGG - Intronic
1115554538 14:34534245-34534267 GCCTGACCTTCCCGAGTAGCTGG + Intronic
1115728453 14:36242123-36242145 GCCTCAACTTCCCGAGTAGCTGG - Intergenic
1115997758 14:39211653-39211675 GCCTCAACCTCCCGAGTGGCTGG - Intergenic
1117185363 14:53234444-53234466 GCCTCACCTTCCCGAGTGGCTGG + Intergenic
1117328319 14:54689044-54689066 GCCTCAACTTCCCGAGTAGCTGG + Intronic
1118185866 14:63538166-63538188 GGATCAACTTCCCGAGTAGCTGG - Intronic
1118993535 14:70817411-70817433 GCCTCAACCTCCCGAGTGGCTGG + Intergenic
1119339237 14:73861990-73862012 GGCTCAGCTTCCCGAGTAGCTGG + Intronic
1119402504 14:74372947-74372969 GCCTCAACTTCCCGAGTAGCTGG - Intergenic
1119676512 14:76559779-76559801 GCCTCAGGTTCCCGAGTAGCTGG + Intergenic
1121508219 14:94492618-94492640 GGGTGATGTTCCTGAGTAGCAGG + Intronic
1121924988 14:97919288-97919310 GGCTGAGGTTCCAGGGTGGATGG + Intergenic
1122709825 14:103648063-103648085 GCCTCAAGCTCCCGAGTAGCTGG + Intronic
1122830347 14:104392781-104392803 GGCTGTGGTTCCCGAGGGCCTGG + Intergenic
1123461024 15:20471988-20472010 GCCTGAGCTTCCCGAGTAGCTGG + Intergenic
1123657036 15:22528392-22528414 GCCTGAGCTTCCCGAGTAGCTGG - Intergenic
1123734850 15:23175546-23175568 GGCTCAGCCTCCCGAGTGGCTGG - Intergenic
1124271669 15:28287836-28287858 GCCTGAGCTTCCCGAGTAGCTGG + Intronic
1124285352 15:28396851-28396873 GGCTCAGCCTCCCGAGTGGCTGG - Intergenic
1124297345 15:28514790-28514812 GGCTCAGCCTCCCGAGTGGCTGG + Intergenic
1124310949 15:28623568-28623590 GCCTGAGCTTCCCGAGTAGCTGG - Intergenic
1124985747 15:34610946-34610968 GCCTCAGCTTCCCGAGTGGCTGG + Intergenic
1125506879 15:40272301-40272323 GGCTGAAGGTCCCCACCGGCTGG - Exonic
1125562661 15:40648942-40648964 GCCTGAGCTTCCCGAGTAGCTGG + Intronic
1125835359 15:42745933-42745955 GGAGGAAGATCCTGAGTGGCTGG + Exonic
1126167839 15:45668583-45668605 GGCTGAAGCTCCCGGATGCCAGG + Intronic
1126663440 15:51054176-51054198 GCCTAAACTTCCCGAGTAGCTGG - Intergenic
1126757037 15:51935002-51935024 GGCTCAGCTTCCCGAGTAGCTGG - Intronic
1127117937 15:55745393-55745415 GCCTCAACTTCCCGAGTAGCTGG - Intergenic
1127801401 15:62480326-62480348 GCCTCAACTTCCCGAGTAGCTGG + Intronic
1128088790 15:64905015-64905037 GCCTCAAGCTCCCGAGTAGCTGG - Intronic
1128672844 15:69587154-69587176 GGCTGAAGTTCCGTAGTCACAGG + Intergenic
1128874672 15:71192395-71192417 GCCTCAAGTACCCGAGTGGCTGG + Intronic
1129316452 15:74748366-74748388 GGCTGAAAATCAGGAGTGGCTGG + Intergenic
1129827280 15:78641929-78641951 GGCTGCAGTTCCCGAGGTGGGGG - Intronic
1129834553 15:78693901-78693923 GTCTCAGGTTCCCGAGTAGCTGG + Intronic
1130266225 15:82406830-82406852 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1130584269 15:85168334-85168356 GCCTCAACTTCCCGAGTAGCTGG - Intergenic
1131099240 15:89674999-89675021 GCCTCAGGTTCCCGAGTAGCCGG - Intronic
1131813948 15:96202898-96202920 GCCTCAGCTTCCCGAGTGGCTGG - Intergenic
1132265525 15:100466966-100466988 GCCTCAGGCTCCCGAGTGGCTGG + Intronic
1133185912 16:4098346-4098368 GTCTCAATTTCCCGAGTAGCTGG + Intronic
1133199904 16:4197534-4197556 GTCTCAAGTTCCTGAGTAGCTGG + Intronic
1133234399 16:4381165-4381187 TGCTGAGGTTGGCGAGTGGCTGG - Exonic
1133263958 16:4571962-4571984 GCCTGAGCTTCCCGAGTAGCTGG + Intronic
1133371494 16:5248871-5248893 GGCTCAGCTTCCCGAGTAGCTGG - Intergenic
1133800974 16:9085049-9085071 GCCTGAGGCTCCCGAGTAGCTGG - Intergenic
1133888969 16:9860331-9860353 GCCTCAACTTCCCGAGTAGCTGG - Intronic
1134629553 16:15746971-15746993 GTCTGAGCCTCCCGAGTGGCTGG - Intronic
1134691041 16:16191228-16191250 GCCTGAGCTTCCCGAGTAGCTGG + Intronic
1135059094 16:19255668-19255690 GGCTCAGGTTCCTGAGTAGCTGG - Intronic
1135707168 16:24685002-24685024 GGCTGAAGTTCCCAAGAGCATGG - Intergenic
1135711463 16:24720938-24720960 GCCTCAGCTTCCCGAGTGGCTGG - Intergenic
1136081565 16:27855603-27855625 GCCTCAGGTTCCCGAGTAGCTGG - Intronic
1136131619 16:28225518-28225540 ACCTAAAGTTCCCGAGTAGCTGG - Intergenic
1136510094 16:30732334-30732356 GCCTCAGCTTCCCGAGTGGCTGG - Intronic
1136851428 16:33615496-33615518 GCCTCAGCTTCCCGAGTGGCTGG + Intergenic
1138771952 16:59676177-59676199 GCCTCAACCTCCCGAGTGGCTGG - Intergenic
1139474787 16:67197765-67197787 GGGTGAAGTTCCTGATGGGCAGG + Intronic
1139602504 16:67995013-67995035 GCCTTAACTTCCCGAGTAGCTGG + Intronic
1139605074 16:68012525-68012547 GCCTGAGGTTCCTGAGTAGCTGG + Intronic
1139802443 16:69534373-69534395 GCCTCAGCTTCCCGAGTGGCTGG - Intergenic
1139905580 16:70363449-70363471 GGCTCAGCTTCCCGAGTAGCTGG + Intronic
1140439640 16:74977571-74977593 GCCTTAGCTTCCCGAGTGGCTGG - Intronic
1140498220 16:75408659-75408681 GCCTCAGGCTCCCGAGTGGCTGG - Intronic
1140625491 16:76789252-76789274 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1141603652 16:85141026-85141048 GCCTCAGGCTCCCGAGTGGCTGG + Intergenic
1203113031 16_KI270728v1_random:1463959-1463981 GCCTCAGCTTCCCGAGTGGCTGG + Intergenic
1142653312 17:1371951-1371973 GCCTCAACTTCCCGAGTAGCTGG + Intronic
1142654750 17:1384088-1384110 GCCTCATCTTCCCGAGTGGCTGG - Intronic
1143019209 17:3907930-3907952 GGCTGAAGGTGCCGAGAGGGAGG - Intronic
1143078225 17:4363835-4363857 GCCTGAGCTTCCCGAGTAGCTGG - Intronic
1143366478 17:6411938-6411960 GCCTCAACTTCCCGAGTAGCTGG - Intronic
1143532490 17:7513375-7513397 GGGTGAAGTTGGCGAGTAGCTGG - Exonic
1143542230 17:7576056-7576078 GCCTGAGCTTCCCGAGTAGCTGG - Intronic
1143555407 17:7656769-7656791 GCCTCAGGTTCCCGAGTAGCTGG + Exonic
1143814699 17:9502989-9503011 GCCTCAGCTTCCCGAGTGGCTGG - Intronic
1145210536 17:21009838-21009860 GCCTCAACCTCCCGAGTGGCTGG - Intronic
1145914642 17:28564598-28564620 GCCTGAGCTTCCCGAGTAGCTGG - Intronic
1146999510 17:37351023-37351045 GCCTCAGGTTCCCGAGTAGCTGG - Intronic
1147014988 17:37484644-37484666 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1147296114 17:39483955-39483977 GCCTCAACTTCCCAAGTGGCTGG + Intronic
1147714686 17:42497557-42497579 GCCTCAACTTCCCGAGTAGCTGG - Intronic
1148501114 17:48092103-48092125 GCCTCAACCTCCCGAGTGGCTGG + Intronic
1149698859 17:58638651-58638673 GCCTCAACCTCCCGAGTGGCTGG + Intronic
1149816813 17:59733585-59733607 GCCTGAGCTTCCCGAGTAGCTGG - Intronic
1150100187 17:62416611-62416633 GGCTGAGCCTCCCGAGTAGCTGG + Intergenic
1150588237 17:66537918-66537940 GCCTCAGCTTCCCGAGTGGCTGG + Intronic
1151352942 17:73542461-73542483 GGCTGGAGTTCGCTTGTGGCAGG - Intronic
1151610638 17:75172130-75172152 GGCTCAATCTCCCGAGTAGCTGG + Intergenic
1151938329 17:77277708-77277730 GCCTCAACTTCCCGAGTAGCAGG + Intergenic
1152081733 17:78191556-78191578 GCCTCAGGTTCCCGAGTAGCTGG - Intronic
1152698708 17:81808632-81808654 GCCTCAAGCTCCCGAGTAGCTGG + Intronic
1152837888 17:82546534-82546556 CGCTGCAGGTCCCGAGTGGAGGG + Intronic
1153185854 18:2485553-2485575 GCCTCAGCTTCCCGAGTGGCTGG + Intergenic
1158462426 18:57658159-57658181 GCCTCAGGCTCCCGAGTGGCTGG + Intronic
1158476294 18:57782925-57782947 GGCTCAACCTCCCGAGTAGCTGG + Intronic
1158698504 18:59724854-59724876 GCCTCAGCTTCCCGAGTGGCTGG - Intergenic
1158940263 18:62401085-62401107 GGCTGATCTTCACAAGTGGCAGG - Intergenic
1160878127 19:1307213-1307235 GCCTCAGCTTCCCGAGTGGCTGG + Intergenic
1161694993 19:5761838-5761860 GACTATAGTTCCCGAGTAGCTGG + Intronic
1162617943 19:11816743-11816765 GCCTCAGCTTCCCGAGTGGCTGG + Intronic
1162697463 19:12487399-12487421 GGCTCAGCTTCCCGAGTAGCTGG + Intronic
1162959517 19:14117718-14117740 GGCTGAGGTTCCCGGGCGGGCGG - Exonic
1163071101 19:14842363-14842385 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1163304175 19:16467261-16467283 GCCTCAGGGTCCCGAGTGGCCGG + Intronic
1163307745 19:16492339-16492361 GCCTGAGCTTCCCGAGTAGCTGG - Intronic
1163409472 19:17144853-17144875 GGCTCAGCCTCCCGAGTGGCTGG - Intronic
1163563545 19:18035749-18035771 GCCTCAGCTTCCCGAGTGGCTGG + Intergenic
1163627822 19:18400771-18400793 GCCTTAGGTTCCCGAGTAGCTGG - Intergenic
1163637778 19:18445419-18445441 GGCTGTAGCTCCGGAGTGGGTGG + Intronic
1163658254 19:18560819-18560841 GCCTCAAGCTCCCGAGTAGCTGG + Intronic
1163987783 19:20969359-20969381 GCCTCAACTTCCCGAGTAGCTGG - Intergenic
1165088786 19:33371352-33371374 GCCTCAGGCTCCCGAGTGGCTGG + Intergenic
1166137735 19:40787418-40787440 GCCTCAACTTCCCGAGTAGCTGG - Intronic
1166301428 19:41913876-41913898 GGCTGAAGTGCCTGAGGGGAGGG - Intronic
1167010692 19:46805355-46805377 GGCTCAGCTTCCCGAGTAGCTGG - Intergenic
1167065725 19:47184523-47184545 GCCTCAACTTCCCGAGTAGCTGG + Intronic
1167073500 19:47234491-47234513 GCCTCAAGCTCCCGAGTAGCTGG - Intergenic
1167105045 19:47425232-47425254 GGCTCAGCCTCCCGAGTGGCTGG - Intergenic
1168006019 19:53488137-53488159 GCCTCAATTTCCCGAGTAGCTGG + Intronic
1168578359 19:57532957-57532979 GCCTCAACCTCCCGAGTGGCTGG + Intronic
1168670906 19:58240370-58240392 GCCTCAACTTCCCGAGTAGCTGG + Intronic
925054672 2:847909-847931 AGCTGAAATTCCCCAGTGCCTGG - Intergenic
925491464 2:4399752-4399774 GCCTCAACTTCCCGAGTAGCTGG - Intergenic
925953769 2:8940404-8940426 GCCTCAAGCTCCCGAGTAGCTGG + Intronic
926549414 2:14283212-14283234 GTCTCAGTTTCCCGAGTGGCTGG - Intergenic
927537091 2:23871990-23872012 GCCTCAAGTTCCCAAGTAGCTGG + Intronic
927689863 2:25200904-25200926 GCCTCAGCTTCCCGAGTGGCTGG - Intergenic
927838757 2:26423205-26423227 TGCTGAAGGTCCCAGGTGGCAGG + Intronic
928513415 2:32022630-32022652 GCCTGAGCCTCCCGAGTGGCTGG + Intronic
929056704 2:37884402-37884424 GCCTCAGGTTCCCGAGTAGCTGG + Intergenic
929998341 2:46843892-46843914 GTCTCAGCTTCCCGAGTGGCTGG + Intronic
930794055 2:55369147-55369169 GCCTCAACTTCCCGAGTAGCTGG + Intronic
931379175 2:61736257-61736279 GGCTGAGCCTCCCGAGTAGCTGG + Intergenic
931467731 2:62506084-62506106 GGCTGAAGTTTCCCAGCCGCTGG + Exonic
931541958 2:63339286-63339308 GCCTCAACTTCCCGAGTAGCTGG + Intronic
931568656 2:63644356-63644378 GCCTCAGGTTCCCGAGTAGCTGG + Intronic
931769437 2:65485152-65485174 GGCTCAACCTCCCGAGTAGCTGG + Intergenic
932940124 2:76154487-76154509 GCCTCAAGCTCCCAAGTGGCTGG + Intergenic
933066934 2:77809057-77809079 GCCTCAGGTTCCCGAGTAGCTGG - Intergenic
933146679 2:78862259-78862281 GCCTCAACCTCCCGAGTGGCTGG - Intergenic
933369987 2:81402204-81402226 GGCTCAGCCTCCCGAGTGGCTGG - Intergenic
933701262 2:85256866-85256888 GCCTCAGCTTCCCGAGTGGCTGG - Intronic
934237333 2:90244280-90244302 GGCTTAACTTCCTGAGTAGCTGG - Intergenic
934614904 2:95764727-95764749 GGCTGCAGGTCCCTAGTGGCAGG + Intergenic
934624526 2:95835526-95835548 GGCTGAAGTCCCCGGTTGGGAGG - Intergenic
934645999 2:96059760-96059782 GGCTGCAGGTCCCTAGTGGCAGG - Intergenic
934675026 2:96243701-96243723 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
934743646 2:96744088-96744110 GCCTCAACCTCCCGAGTGGCTGG - Intergenic
934839402 2:97615850-97615872 GGCTGCAGGTCCCTAGTGGCAGG - Intergenic
934841311 2:97625915-97625937 TGCTGGAGTTCCTGAGTGACAGG + Intergenic
935100939 2:99995485-99995507 GCCTCAACTTCCCGAGTAGCTGG + Intronic
935466556 2:103405386-103405408 GCCTCAGGTTCCCGAGTAGCTGG - Intergenic
935886342 2:107623700-107623722 GCCTCAGCTTCCCGAGTGGCCGG - Intergenic
936347209 2:111684160-111684182 GGTGGGAGTTCCCTAGTGGCTGG + Intergenic
937441526 2:121919788-121919810 GGCTGAGGTTCTGGAGTGGGTGG + Intergenic
938573399 2:132583010-132583032 GGCTCATGATCCCAAGTGGCTGG + Intronic
940369535 2:152885325-152885347 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
942036319 2:172013933-172013955 GGCTCAGCTTCCCGAGTAGCTGG + Intronic
943540166 2:189204010-189204032 GGCTCAGCTTCCCGAGTAGCTGG + Intergenic
943948508 2:194098515-194098537 GTCTGAACTTCCTGAGTAGCTGG + Intergenic
944175279 2:196822027-196822049 GCCTCAGCTTCCCGAGTGGCTGG + Intergenic
944378986 2:199085031-199085053 GTCTCATGTTCCCGAGTAGCTGG - Intergenic
944650160 2:201821783-201821805 GCCTCAGCTTCCCGAGTGGCTGG + Intronic
944864172 2:203844968-203844990 GGCTCAGCTTCCCGAGTAGCTGG + Intergenic
944979744 2:205102951-205102973 GGCTCAGCCTCCCGAGTGGCTGG - Intronic
945685520 2:212964713-212964735 GCCTCAAGCTCCCGAGTAGCTGG - Intergenic
947566455 2:231197240-231197262 GCCTCAGCTTCCCGAGTGGCTGG + Intergenic
947697129 2:232200896-232200918 GGCTCAGCTTCCCGAGTAGCTGG + Intronic
948996953 2:241585796-241585818 GCCTCAACTTCCCGAGTAGCTGG - Intronic
1169133302 20:3179430-3179452 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1169241639 20:3986364-3986386 GCCTCAGCTTCCCGAGTGGCTGG + Intronic
1170442092 20:16389570-16389592 GGCTGAAGTTTCCTAGGGGATGG - Intronic
1171962941 20:31508187-31508209 GGCTCAGCTTCCCGAGTAGCTGG + Intergenic
1172140332 20:32718287-32718309 GGCTCAACCTCCCGAGTAGCTGG - Intronic
1172839658 20:37894665-37894687 GGCTGAAGTCACACAGTGGCTGG - Intergenic
1173184853 20:40832724-40832746 AGATGAGGTTCCCGAGTGTCAGG + Intergenic
1173391644 20:42640501-42640523 GCCTCAGGTTCCCGAGTAGCTGG + Intronic
1174222731 20:48970198-48970220 GCCTCAGCTTCCCGAGTGGCTGG - Intronic
1174743575 20:53039989-53040011 GCCTCAACCTCCCGAGTGGCTGG - Intronic
1175866539 20:62180778-62180800 GCCTCAGGTTCCCGAGTAGCTGG - Exonic
1176924491 21:14731080-14731102 GTCTCAACTTCCCGAGTAGCTGG - Intergenic
1177433970 21:21026508-21026530 GCCTCAAGTTCCTGAGTAGCTGG - Intronic
1178451448 21:32705032-32705054 GCCTCAACTTCCCGAGTAGCTGG - Intronic
1178944002 21:36931166-36931188 GCCTCAACTTCCCGAGTAGCTGG - Intronic
1179088079 21:38238101-38238123 GGCTGAAGTCACCTGGTGGCAGG + Intronic
1179216130 21:39368518-39368540 GCCTCAACTTCCCGAGTAGCTGG - Intergenic
1179451140 21:41469171-41469193 GGCTGAAGCCCCAGGGTGGCGGG - Intronic
1179518046 21:41923108-41923130 GCCTCAAACTCCCGAGTGGCTGG + Intronic
1179682722 21:43035758-43035780 GCCTGAGCTTCCCGAGTAGCTGG - Intergenic
1179983875 21:44910621-44910643 GACAGAAGTTCCCGGGAGGCTGG - Intronic
1181062457 22:20288179-20288201 GGGTGATGTTCCAGAGGGGCAGG - Intergenic
1181105191 22:20570137-20570159 GCCTCAGGTTCCCGAGTAGCTGG + Intronic
1181274333 22:21679009-21679031 GGCTCAGCCTCCCGAGTGGCTGG + Intronic
1181371741 22:22424489-22424511 GGCTCAACCTCCCGAGTAGCTGG - Intergenic
1182291052 22:29280180-29280202 GGCTTAGCTTCCCGAGTAGCTGG + Intronic
1182594732 22:31410338-31410360 GCCTCAAATTCCCGAGTAGCTGG - Intronic
1182913726 22:34008970-34008992 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1183156148 22:36076893-36076915 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1183206094 22:36419957-36419979 GGCTCAGCCTCCCGAGTGGCTGG - Intergenic
1183394969 22:37566466-37566488 GGCGGAAGTCCCCGAGTGGGTGG - Exonic
1183794140 22:40101105-40101127 GCCTCAACCTCCCGAGTGGCTGG + Intronic
1183801846 22:40173209-40173231 GCCTCAGGTTCCCGAGTAGCTGG + Intronic
1184541807 22:45130828-45130850 GCCTCAGGTTCCCGAGTAGCTGG - Intergenic
1184655776 22:45941394-45941416 GGCTCAGCTTCCCGAGTAGCTGG - Intronic
1184726211 22:46348123-46348145 CCCTGGAGTTCCCAAGTGGCAGG - Intronic
1184890431 22:47375773-47375795 GACTGAAGTGCCCGAGGGGCCGG + Intergenic
1185093327 22:48789392-48789414 GCCTCAGCTTCCCGAGTGGCTGG - Intronic
950238288 3:11343041-11343063 GCCTCAACTTCCCGAGTAGCTGG + Intronic
950723990 3:14904126-14904148 GGCTGAAGTCACCTGGTGGCAGG + Intronic
951544424 3:23810619-23810641 GTCTGTGGTGCCCGAGTGGCGGG + Intronic
952802504 3:37309135-37309157 GCCTCAACTTCCCGAGTAGCTGG - Intronic
953520463 3:43637351-43637373 GCCTCAATCTCCCGAGTGGCTGG - Intronic
953995323 3:47514682-47514704 GGCTCAGCCTCCCGAGTGGCTGG - Intergenic
954190623 3:48957828-48957850 GCCTCAACTTCCCGAGTAGCTGG + Intronic
954220068 3:49147945-49147967 GCCTCAGCTTCCCGAGTGGCTGG - Intergenic
955817618 3:62862329-62862351 GCCTCAACTTCCCGAGTAGCTGG + Intronic
955883850 3:63576674-63576696 GCCTCAACTTCCCGAGTAGCTGG - Intronic
958118705 3:89256454-89256476 GCCTCAGGTTCCCGAGTAGCTGG - Intronic
959475137 3:106801995-106802017 GCCTGAACCTCCCGAGTAGCTGG + Intergenic
960431290 3:117571685-117571707 GCCTCAGGCTCCCGAGTGGCTGG + Intergenic
961187855 3:124931631-124931653 GCCTCAGTTTCCCGAGTGGCTGG - Intronic
962086541 3:132197648-132197670 GCCTCAACTTCCCGAGTAGCTGG + Intronic
962200095 3:133393921-133393943 GTCTGAAGATCACGACTGGCTGG - Intronic
962481223 3:135800355-135800377 GGCTGATGTGCCCTAGTGGCAGG - Intergenic
963784772 3:149523361-149523383 GCCTCAGCTTCCCGAGTGGCTGG + Intronic
964748257 3:160031798-160031820 GGCTGAAGTTCCCGAGTGGCTGG - Intergenic
965877743 3:173348477-173348499 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
967435384 3:189438958-189438980 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
967880718 3:194299401-194299423 GCCTCAGGCTCCCGAGTGGCTGG + Intergenic
968114288 3:196077635-196077657 GCCTCAGGCTCCCGAGTGGCTGG - Intronic
968767908 4:2483939-2483961 GCCTCAGGTTCCCGAGTAGCTGG + Intronic
969015051 4:4098497-4098519 GGCTCAGCTTCCCGAGTAGCTGG + Intergenic
969738876 4:9009787-9009809 GGCTCAGCTTCCCGAGTAGCTGG - Intergenic
973868457 4:55139072-55139094 GCCTCAGCTTCCCGAGTGGCTGG - Intergenic
973955555 4:56059796-56059818 GCCTCAGGTTCCCGAGTAGCTGG + Intergenic
974014328 4:56635006-56635028 GCCTGAGCTTCCCGAGTAGCTGG - Intergenic
974416479 4:61613627-61613649 GCCTCAATCTCCCGAGTGGCTGG - Intronic
975553944 4:75640947-75640969 GCCTCAGTTTCCCGAGTGGCTGG - Intergenic
976124530 4:81819283-81819305 GCCTCAGGCTCCCGAGTGGCTGG - Intronic
976639130 4:87319065-87319087 GTCTAAACTTCCCGAGTAGCTGG - Intronic
978005697 4:103613432-103613454 GCCTCAACTTCCCGAGTAGCTGG + Intronic
978792011 4:112672467-112672489 GGCTCAGCTTCCCGAGTAGCTGG - Intergenic
979313106 4:119227513-119227535 GGCTCAGCTTCCCGAGTAGCTGG - Intronic
979400225 4:120240128-120240150 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
979566063 4:122155436-122155458 GCCTCAAGCTCCCGAGTAGCTGG + Intronic
979709166 4:123757416-123757438 GCCTCAGGCTCCCGAGTGGCTGG + Intergenic
981424338 4:144586035-144586057 GCCTCAAGTTCCAGAGTAGCTGG + Intergenic
983420958 4:167516448-167516470 GGCTGAAGTTCCTGAGTGACAGG - Intergenic
984544888 4:181089605-181089627 GGCTCAGCTTCCCGAGTAGCTGG - Intergenic
984656209 4:182321509-182321531 GCCTGAACCTCCCGAGTAGCTGG - Intronic
984916208 4:184726998-184727020 GCCTCAGCTTCCCGAGTGGCTGG - Intronic
986019103 5:3784318-3784340 GACTGAAGCTCCCCTGTGGCAGG + Intergenic
986317539 5:6600634-6600656 GACTGAAGCTCCTGAGAGGCTGG + Intronic
986547583 5:8915409-8915431 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
986663432 5:10079185-10079207 GCCTCAACTTCCCGAGTGGCTGG - Intergenic
988533128 5:32042456-32042478 GCCTCAGGTTCCCGAGTAGCTGG - Intronic
988769696 5:34420075-34420097 GCCTCAAGCTCCCGAGTAGCTGG - Intergenic
988826529 5:34941679-34941701 GCCTCAAGCTCCCGAGTAGCTGG + Intronic
989540798 5:42616420-42616442 GGCTTAAGTACCTGAGTGGATGG + Intronic
990480558 5:56206373-56206395 GGCAGTAGTTCCCGAATGACTGG + Intronic
991321304 5:65376334-65376356 GCCTCAACTTCCCGAGTAGCTGG - Intronic
991676782 5:69095952-69095974 GCCTCAACTTCCTGAGTGGCTGG - Intronic
992626207 5:78637886-78637908 GGCTGATGTTCCAGAGTTGTGGG - Intronic
993710077 5:91215848-91215870 GCCTGAGCCTCCCGAGTGGCTGG - Intergenic
993993090 5:94684581-94684603 GGCTCAGGCTCCCGAGTAGCTGG - Intronic
994372783 5:98986077-98986099 GCCTCAGCTTCCCGAGTGGCTGG - Intergenic
996305020 5:122037011-122037033 GCCTCAAGCTCCCGAGTAGCTGG + Intronic
997714749 5:136033906-136033928 GGCTGCAGTTCCCCAGGGCCTGG + Intronic
998107931 5:139480429-139480451 GGCTCAGGTTCCCGAGTAGCTGG - Intronic
998833233 5:146181236-146181258 GCCTCAACTTCCCGAGTAGCTGG - Intronic
998845909 5:146309788-146309810 GCCTGAACCTCCCGAGTAGCTGG + Intronic
999299742 5:150484006-150484028 GCCTCAGGCTCCCGAGTGGCTGG + Intergenic
999651353 5:153770561-153770583 GGCTGAAGATCTTGGGTGGCTGG - Intronic
999982193 5:156968240-156968262 GCCTCAGTTTCCCGAGTGGCTGG - Intergenic
1000712894 5:164602299-164602321 GCCTCAACTTCCCGAGTAGCTGG - Intergenic
1000891551 5:166808242-166808264 GCCTCAACTTCCCGAGTAGCTGG - Intergenic
1001387053 5:171348527-171348549 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1001792700 5:174473480-174473502 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1002353378 5:178601972-178601994 GACTCAGTTTCCCGAGTGGCTGG - Intergenic
1002422715 5:179157618-179157640 ACCTCAGGTTCCCGAGTGGCTGG + Intronic
1002631162 5:180579823-180579845 GTCTCAGCTTCCCGAGTGGCTGG - Intergenic
1002935693 6:1670174-1670196 GGCAGAAGTCCCCGAGCTGCTGG - Intronic
1003919183 6:10816118-10816140 GTCTTACCTTCCCGAGTGGCTGG + Intronic
1004036022 6:11924942-11924964 GCCTCAGGTTCCCGAGTAGCTGG - Intergenic
1004383785 6:15154756-15154778 GCCTCAGGTTCCCGAGTAGCTGG - Intergenic
1004661114 6:17710047-17710069 GCCTCAGCTTCCCGAGTGGCTGG - Intergenic
1006106008 6:31717133-31717155 GCCTCAGGTTCCCGAGTAGCTGG - Intronic
1006276973 6:33012428-33012450 GCCTCAGCTTCCCGAGTGGCTGG + Intergenic
1006667035 6:35702565-35702587 GCCTCAACTTCCCGAGTAGCTGG + Intronic
1006966882 6:37996012-37996034 GCCTGAGCTTCCCGAGTAGCTGG - Intronic
1007611467 6:43151957-43151979 GCCTGAACCTCCCGAGTAGCTGG + Intronic
1008034783 6:46734706-46734728 GCCTCAACTTCCCGAGTAGCTGG - Intronic
1008617554 6:53241120-53241142 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1009597854 6:65759368-65759390 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1009865895 6:69397700-69397722 GCCTCAAGCTCCCGAGTAGCTGG + Intergenic
1010107190 6:72183164-72183186 GGCTGAAGTCCCCGCACGGCCGG - Intronic
1010973862 6:82291335-82291357 GCCTCAGGTTCCTGAGTGGCTGG - Intergenic
1011423562 6:87201517-87201539 GCCTCAGCTTCCCGAGTGGCTGG + Intronic
1012314920 6:97774100-97774122 GGCTCAGCTTCCCGAGTAGCTGG + Intergenic
1012328118 6:97949630-97949652 GCCTCAAGTTCCTGAGTAGCTGG + Intergenic
1013357945 6:109363060-109363082 GCCTCAGCTTCCCGAGTGGCTGG - Intergenic
1014205251 6:118650614-118650636 GGCTGAAGTTCCCTTGGGGGTGG + Intronic
1014964605 6:127731810-127731832 GCCTCAGGTTCCCGAGTAGCTGG + Intronic
1014998385 6:128182457-128182479 GTCTCAACTTCCCGAGTAGCTGG - Intronic
1017489897 6:154935743-154935765 GCCTCAACCTCCCGAGTGGCTGG - Intronic
1018330040 6:162717467-162717489 GGCTCAACTTCCCGAATAGCTGG - Intronic
1018844640 6:167547242-167547264 GGCTGGAGTCCCCGAGTCGGTGG + Intergenic
1018886933 6:167947292-167947314 GCCTTAGCTTCCCGAGTGGCTGG + Intronic
1019355118 7:574390-574412 GGCTGCAGGTCCAGTGTGGCCGG + Intronic
1020223049 7:6256227-6256249 GGCAGAAGTTCTCGAGTCTCAGG - Intronic
1021724183 7:23533688-23533710 GGCTCAGCTTCCCGAGTAGCTGG + Intergenic
1023096895 7:36670587-36670609 GCCTCAAGCTCCCGAGTAGCTGG + Intronic
1023928485 7:44688862-44688884 GCCTGAACCTCCCGAGTAGCTGG + Intronic
1024069257 7:45772018-45772040 GCCTCAGGTTCCCGAGTAGCTGG + Intergenic
1024609126 7:51048050-51048072 GCCTCAACTTCCCGAGTAGCTGG - Intronic
1025214300 7:57042981-57043003 GCCTTAAGTTCCCGAGTAGTGGG + Intergenic
1025657653 7:63533832-63533854 GCCTTAAGTTCCCGAGTAGTGGG - Intergenic
1025932999 7:66011323-66011345 GCCTCAAATTCCCGAGTAGCTGG - Intergenic
1026560383 7:71443837-71443859 GCCTCAGCTTCCCGAGTGGCTGG + Intronic
1026866485 7:73827258-73827280 GGCTTAACCTCCCGAGTAGCTGG - Intronic
1026915806 7:74119791-74119813 GCCTCAATTTCCCGAGTAGCTGG - Intronic
1026982939 7:74537296-74537318 GCCTCAACCTCCCGAGTGGCTGG - Intronic
1026988601 7:74570246-74570268 GCCTCAAGCTCCCGAGTAGCTGG - Intronic
1027221556 7:76217397-76217419 GCCTCAACTTCCCGAGTAGCTGG + Intronic
1027410076 7:77906791-77906813 GCCTCAGGCTCCCGAGTGGCTGG - Intronic
1027566400 7:79800270-79800292 GCCTCAGCTTCCCGAGTGGCTGG - Intergenic
1027599555 7:80222500-80222522 GCCTCAGGTTCCCGAGTAGCTGG + Intergenic
1027755157 7:82203126-82203148 GGCTGAAGTGCCCGGCTTGCAGG + Intronic
1028046475 7:86126809-86126831 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1029073722 7:97920120-97920142 GGCTCAGCTTCCCGAGTAGCTGG + Intergenic
1029173795 7:98649430-98649452 GCCTCAACTTCCCGAGTAGCTGG + Intergenic
1029486935 7:100849039-100849061 GCCTGAACCTCCCGAGTAGCTGG + Intronic
1029592115 7:101514221-101514243 GCCTCAACTTCCCGAGTAGCTGG - Intronic
1029630445 7:101746920-101746942 GCCTCAAGCTCCCGAGTGGCTGG - Intergenic
1032097995 7:128949029-128949051 GGCTGAATTTCCCGAGAGCCAGG - Intronic
1032540779 7:132701188-132701210 GCCTCAACTTCCCGAGTAGCTGG + Intronic
1033074560 7:138236411-138236433 GCCTCAAGCTCCCGAGTAGCTGG + Intergenic
1033369565 7:140696287-140696309 GCCTCAACTTCCCGAGTAGCTGG - Intronic
1033408779 7:141096796-141096818 GACAGAAGTTCCAGAGAGGCTGG + Intronic
1033453735 7:141483848-141483870 GTCTTAACTTCCCGAGTAGCTGG + Intergenic
1034066038 7:148137545-148137567 GCCTCAACCTCCCGAGTGGCTGG - Intronic
1034383744 7:150720804-150720826 GGCTGAAGTCCCCCAGGAGCTGG + Exonic
1034693595 7:153034515-153034537 GCCTCAGCTTCCCGAGTGGCTGG + Intergenic
1035770451 8:2142868-2142890 GCCTCAACTTCCCGAGTAGCTGG + Intronic
1036243971 8:7101139-7101161 GGCTCAGCTTCCCGAGTAGCTGG - Intergenic
1036256827 8:7212912-7212934 GGCTCAGCTTCCCGAGTAGCTGG + Intergenic
1036308877 8:7671511-7671533 GGCTCAGCTTCCCGAGTAGCTGG + Intergenic
1036360664 8:8074600-8074622 GGCTCAGCTTCCCGAGTAGCTGG - Intergenic
1036780013 8:11640144-11640166 GGCTCAACCTCCCGAGTAGCTGG + Intergenic
1036847088 8:12177848-12177870 GCCTCAACCTCCCGAGTGGCTGG + Intergenic
1036868455 8:12420169-12420191 GCCTCAACCTCCCGAGTGGCTGG + Intergenic
1036890306 8:12592366-12592388 GGCTCAGCTTCCCGAGTAGCTGG + Intergenic
1036897872 8:12650283-12650305 GGCTCAGCTTCCCGAGTAGCTGG + Intergenic
1037322484 8:17656942-17656964 GCCTCAACTTCCCGAGTAGCTGG - Intronic
1037908376 8:22728710-22728732 GCCTCAACTTCCCGAGTAGCTGG + Intronic
1039449341 8:37659099-37659121 GGCTGAACCTCCTGAGTAGCTGG - Intergenic
1039603503 8:38862008-38862030 GCCTCAGGTTCCCGAGTAGCTGG - Intergenic
1040001755 8:42582974-42582996 GGCTCAGCTTCCCGAGTAGCTGG + Intergenic
1040847900 8:51863810-51863832 GGCTCAGCTTCCCGAGTAGCTGG - Intronic
1041493633 8:58462556-58462578 GCCTCAACCTCCCGAGTGGCTGG + Intergenic
1044639903 8:94368020-94368042 GGCAGCAGTTGCAGAGTGGCTGG + Intergenic
1044990437 8:97790852-97790874 GTCTCAACTTCCCGAGTAGCTGG + Intronic
1045754776 8:105529843-105529865 GCCTCAACTTCCCGAGTAGCTGG + Intronic
1045993836 8:108340278-108340300 GCCTGAACTTCCCTAGTAGCTGG - Intronic
1046923936 8:119766717-119766739 GCCTCAACTTCCCGAGTAGCTGG - Intronic
1047197330 8:122733719-122733741 GGCTGAAGTTCACGACCGGACGG - Intergenic
1047956211 8:129978021-129978043 GCCTTAAGCTCCCGAGTAGCTGG + Intronic
1049635742 8:143688085-143688107 GCCTCAACTTCCCGAGTAGCTGG + Intronic
1053212759 9:36245147-36245169 GCCTCAACCTCCCGAGTGGCTGG - Intronic
1054912178 9:70464903-70464925 GCCTCAGCTTCCCGAGTGGCTGG - Intergenic
1055446883 9:76393319-76393341 GCCTCAGGTTCCCGAGTAGCTGG + Intronic
1056620322 9:88207012-88207034 GGCTCAGCTTCCCGAGTAGCTGG - Intergenic
1058956248 9:109951515-109951537 GCCTGAAGTCCGCTAGTGGCAGG - Intronic
1060151638 9:121292646-121292668 GGCTCAAGTTCCCTGGTGGTAGG + Intronic
1060677573 9:125529057-125529079 GCCTCAACTTCCCGAGTAGCTGG - Intronic
1060798769 9:126530712-126530734 GCCTCAAGCTCCCGAGTAGCTGG + Intergenic
1060931967 9:127494828-127494850 GGCTGGAGTGCCCGAGTAGCTGG - Intronic
1061026807 9:128055158-128055180 GCCTCAATTTCCCGAGTAGCTGG - Intergenic
1062219262 9:135405493-135405515 GCCTCAGGTTCCCGAGTAGCTGG - Intergenic
1062409777 9:136417585-136417607 GCCTCAACTTCCCGAGTAGCTGG + Intronic
1062679050 9:137766930-137766952 AGCTGAGCCTCCCGAGTGGCTGG + Intronic
1185926378 X:4151704-4151726 GCCTCAGGTTCCCAAGTGGCTGG + Intergenic
1187366424 X:18669374-18669396 GCCTCAGGCTCCCGAGTGGCTGG - Intronic
1187389688 X:18877895-18877917 GCCTCAGCTTCCCGAGTGGCTGG + Intergenic
1187869181 X:23750148-23750170 GCCTCAGCTTCCCGAGTGGCTGG - Intronic
1187971659 X:24664841-24664863 GCCTCAGGTTCCCGAGTAGCTGG - Intronic
1188073639 X:25748556-25748578 GTCTCAACCTCCCGAGTGGCTGG - Intergenic
1189158207 X:38781822-38781844 GCCTCAATTTCCCGAGTAGCTGG - Intergenic
1189767393 X:44385720-44385742 GCCTCAAGCTCCCGAGTAGCTGG + Intergenic
1190316212 X:49153277-49153299 GGCTCAACCTCCCGAGTAGCTGG + Intergenic
1190679475 X:52812385-52812407 GCCTCAACTTCCCGAGTAGCTGG + Intronic
1190748698 X:53342570-53342592 GCCTCAACTTCCCGAGTAGCTGG - Intergenic
1190854146 X:54276828-54276850 GCCTCAACCTCCCGAGTGGCTGG + Intronic
1192950328 X:76009779-76009801 GGATGAAGTTCCCAAGGGGAGGG - Intergenic
1193146702 X:78084014-78084036 GTCTCAAGCTCCCGAGTAGCTGG + Intronic
1193654635 X:84184734-84184756 GCCTCAGGTTCCCGAGTAGCTGG - Intronic
1195376175 X:104230379-104230401 GCCTCAAGCTCCCGAGTAGCTGG + Intergenic
1196750160 X:119108745-119108767 GGCTCAGCTTCCCGAGTAGCTGG - Intronic
1197168751 X:123408074-123408096 GCCTCAAGTTCCTGAGTAGCTGG + Intronic
1197462594 X:126761020-126761042 GCCTCAGCTTCCCGAGTGGCTGG - Intergenic
1198687154 X:139238560-139238582 AGCTGAAGCTCCCCATTGGCAGG - Intergenic
1199836352 X:151595608-151595630 GCCTCAACTTCCCGAGTAGCCGG - Intronic
1201227851 Y:11835371-11835393 GGCTCAGGTTCCTGAGTAGCTGG + Intergenic
1201360804 Y:13146652-13146674 GGCTCAGCTTCCTGAGTGGCTGG - Intergenic