ID: 964754282

View in Genome Browser
Species Human (GRCh38)
Location 3:160080025-160080047
Sequence TCTCCATGGATCTACTGTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964754281_964754282 -10 Left 964754281 3:160080012-160080034 CCTACAGGGAATTTCTCCATGGA No data
Right 964754282 3:160080025-160080047 TCTCCATGGATCTACTGTCCTGG No data
964754279_964754282 -3 Left 964754279 3:160080005-160080027 CCTTAATCCTACAGGGAATTTCT No data
Right 964754282 3:160080025-160080047 TCTCCATGGATCTACTGTCCTGG No data
964754274_964754282 29 Left 964754274 3:160079973-160079995 CCTATCATTATTTAGCTGGCTTG No data
Right 964754282 3:160080025-160080047 TCTCCATGGATCTACTGTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964754282 Original CRISPR TCTCCATGGATCTACTGTCC TGG Intergenic