ID: 964762122

View in Genome Browser
Species Human (GRCh38)
Location 3:160144469-160144491
Sequence ATGCCAGAGGGTTCTAGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964762114_964762122 25 Left 964762114 3:160144421-160144443 CCTCACTAGCAGCATGCTAGACC No data
Right 964762122 3:160144469-160144491 ATGCCAGAGGGTTCTAGAGGAGG No data
964762117_964762122 3 Left 964762117 3:160144443-160144465 CCAGACTGCAGGCAATAACTGTG No data
Right 964762122 3:160144469-160144491 ATGCCAGAGGGTTCTAGAGGAGG No data
964762116_964762122 4 Left 964762116 3:160144442-160144464 CCCAGACTGCAGGCAATAACTGT No data
Right 964762122 3:160144469-160144491 ATGCCAGAGGGTTCTAGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964762122 Original CRISPR ATGCCAGAGGGTTCTAGAGG AGG Intergenic
No off target data available for this crispr