ID: 964762664

View in Genome Browser
Species Human (GRCh38)
Location 3:160149012-160149034
Sequence CCAGGTGACAAGAGGGGAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964762664_964762674 20 Left 964762664 3:160149012-160149034 CCTTTTCCCCTCTTGTCACCTGG No data
Right 964762674 3:160149055-160149077 ATGCAGCTTGTGACCATGGTGGG No data
964762664_964762675 23 Left 964762664 3:160149012-160149034 CCTTTTCCCCTCTTGTCACCTGG No data
Right 964762675 3:160149058-160149080 CAGCTTGTGACCATGGTGGGAGG No data
964762664_964762669 -8 Left 964762664 3:160149012-160149034 CCTTTTCCCCTCTTGTCACCTGG No data
Right 964762669 3:160149027-160149049 TCACCTGGACTGCTGATGTATGG No data
964762664_964762672 16 Left 964762664 3:160149012-160149034 CCTTTTCCCCTCTTGTCACCTGG No data
Right 964762672 3:160149051-160149073 TGGCATGCAGCTTGTGACCATGG No data
964762664_964762673 19 Left 964762664 3:160149012-160149034 CCTTTTCCCCTCTTGTCACCTGG No data
Right 964762673 3:160149054-160149076 CATGCAGCTTGTGACCATGGTGG No data
964762664_964762671 -4 Left 964762664 3:160149012-160149034 CCTTTTCCCCTCTTGTCACCTGG No data
Right 964762671 3:160149031-160149053 CTGGACTGCTGATGTATGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964762664 Original CRISPR CCAGGTGACAAGAGGGGAAA AGG (reversed) Intergenic
No off target data available for this crispr