ID: 964763798

View in Genome Browser
Species Human (GRCh38)
Location 3:160158935-160158957
Sequence CAGGGTATTCTAGGAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964763791_964763798 4 Left 964763791 3:160158908-160158930 CCAGATCTTCTCTTTTTGGTATG No data
Right 964763798 3:160158935-160158957 CAGGGTATTCTAGGAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964763798 Original CRISPR CAGGGTATTCTAGGAGAGGA AGG Intergenic
No off target data available for this crispr