ID: 964763906

View in Genome Browser
Species Human (GRCh38)
Location 3:160159960-160159982
Sequence CTGTAGGCAGAAGCTGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964763906_964763911 3 Left 964763906 3:160159960-160159982 CCATCCTCAGCTTCTGCCTACAG No data
Right 964763911 3:160159986-160160008 TCTCACACAGGAGAAAGCCAGGG No data
964763906_964763908 -9 Left 964763906 3:160159960-160159982 CCATCCTCAGCTTCTGCCTACAG No data
Right 964763908 3:160159974-160159996 TGCCTACAGTGTTCTCACACAGG No data
964763906_964763910 2 Left 964763906 3:160159960-160159982 CCATCCTCAGCTTCTGCCTACAG No data
Right 964763910 3:160159985-160160007 TTCTCACACAGGAGAAAGCCAGG No data
964763906_964763912 13 Left 964763906 3:160159960-160159982 CCATCCTCAGCTTCTGCCTACAG No data
Right 964763912 3:160159996-160160018 GAGAAAGCCAGGGCAGTGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964763906 Original CRISPR CTGTAGGCAGAAGCTGAGGA TGG (reversed) Intergenic
No off target data available for this crispr