ID: 964763950

View in Genome Browser
Species Human (GRCh38)
Location 3:160160298-160160320
Sequence GAGGACTCCTTGGGAAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964763950_964763955 -4 Left 964763950 3:160160298-160160320 CCTGATTTTCCCAAGGAGTCCTC No data
Right 964763955 3:160160317-160160339 CCTCCTACAGCTAGGAATTCTGG No data
964763950_964763957 -1 Left 964763950 3:160160298-160160320 CCTGATTTTCCCAAGGAGTCCTC No data
Right 964763957 3:160160320-160160342 CCTACAGCTAGGAATTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964763950 Original CRISPR GAGGACTCCTTGGGAAAATC AGG (reversed) Intergenic
No off target data available for this crispr