ID: 964765444

View in Genome Browser
Species Human (GRCh38)
Location 3:160174455-160174477
Sequence CTCCATCTCACAGTTGTGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964765444_964765448 27 Left 964765444 3:160174455-160174477 CCTCACACAACTGTGAGATGGAG No data
Right 964765448 3:160174505-160174527 TAGATGAGAAAGCCAACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964765444 Original CRISPR CTCCATCTCACAGTTGTGTG AGG (reversed) Intergenic
No off target data available for this crispr