ID: 964767363

View in Genome Browser
Species Human (GRCh38)
Location 3:160191677-160191699
Sequence CAGGCTCACCTGCAGTTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964767363_964767367 -10 Left 964767363 3:160191677-160191699 CCCTAGAACTGCAGGTGAGCCTG No data
Right 964767367 3:160191690-160191712 GGTGAGCCTGAGCTTGGGAAAGG No data
964767363_964767369 20 Left 964767363 3:160191677-160191699 CCCTAGAACTGCAGGTGAGCCTG No data
Right 964767369 3:160191720-160191742 ATTTGAATCACAAGTGTTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964767363 Original CRISPR CAGGCTCACCTGCAGTTCTA GGG (reversed) Intergenic
No off target data available for this crispr