ID: 964767744

View in Genome Browser
Species Human (GRCh38)
Location 3:160195148-160195170
Sequence TGCAAGAATTATTTTCACAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964767744_964767759 24 Left 964767744 3:160195148-160195170 CCCCTGTGAAAATAATTCTTGCA No data
Right 964767759 3:160195195-160195217 AGGCACTGAAATATGGGGCAGGG No data
964767744_964767758 23 Left 964767744 3:160195148-160195170 CCCCTGTGAAAATAATTCTTGCA No data
Right 964767758 3:160195194-160195216 CAGGCACTGAAATATGGGGCAGG No data
964767744_964767755 18 Left 964767744 3:160195148-160195170 CCCCTGTGAAAATAATTCTTGCA No data
Right 964767755 3:160195189-160195211 TGCTCCAGGCACTGAAATATGGG No data
964767744_964767751 4 Left 964767744 3:160195148-160195170 CCCCTGTGAAAATAATTCTTGCA No data
Right 964767751 3:160195175-160195197 CACCCAGATTTTTCTGCTCCAGG No data
964767744_964767756 19 Left 964767744 3:160195148-160195170 CCCCTGTGAAAATAATTCTTGCA No data
Right 964767756 3:160195190-160195212 GCTCCAGGCACTGAAATATGGGG No data
964767744_964767754 17 Left 964767744 3:160195148-160195170 CCCCTGTGAAAATAATTCTTGCA No data
Right 964767754 3:160195188-160195210 CTGCTCCAGGCACTGAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964767744 Original CRISPR TGCAAGAATTATTTTCACAG GGG (reversed) Intergenic
No off target data available for this crispr