ID: 964767751

View in Genome Browser
Species Human (GRCh38)
Location 3:160195175-160195197
Sequence CACCCAGATTTTTCTGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964767744_964767751 4 Left 964767744 3:160195148-160195170 CCCCTGTGAAAATAATTCTTGCA No data
Right 964767751 3:160195175-160195197 CACCCAGATTTTTCTGCTCCAGG No data
964767746_964767751 2 Left 964767746 3:160195150-160195172 CCTGTGAAAATAATTCTTGCACC No data
Right 964767751 3:160195175-160195197 CACCCAGATTTTTCTGCTCCAGG No data
964767745_964767751 3 Left 964767745 3:160195149-160195171 CCCTGTGAAAATAATTCTTGCAC No data
Right 964767751 3:160195175-160195197 CACCCAGATTTTTCTGCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964767751 Original CRISPR CACCCAGATTTTTCTGCTCC AGG Intergenic
No off target data available for this crispr