ID: 964767756

View in Genome Browser
Species Human (GRCh38)
Location 3:160195190-160195212
Sequence GCTCCAGGCACTGAAATATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964767749_964767756 -6 Left 964767749 3:160195173-160195195 CCCACCCAGATTTTTCTGCTCCA No data
Right 964767756 3:160195190-160195212 GCTCCAGGCACTGAAATATGGGG No data
964767746_964767756 17 Left 964767746 3:160195150-160195172 CCTGTGAAAATAATTCTTGCACC No data
Right 964767756 3:160195190-160195212 GCTCCAGGCACTGAAATATGGGG No data
964767744_964767756 19 Left 964767744 3:160195148-160195170 CCCCTGTGAAAATAATTCTTGCA No data
Right 964767756 3:160195190-160195212 GCTCCAGGCACTGAAATATGGGG No data
964767745_964767756 18 Left 964767745 3:160195149-160195171 CCCTGTGAAAATAATTCTTGCAC No data
Right 964767756 3:160195190-160195212 GCTCCAGGCACTGAAATATGGGG No data
964767750_964767756 -7 Left 964767750 3:160195174-160195196 CCACCCAGATTTTTCTGCTCCAG No data
Right 964767756 3:160195190-160195212 GCTCCAGGCACTGAAATATGGGG No data
964767752_964767756 -10 Left 964767752 3:160195177-160195199 CCCAGATTTTTCTGCTCCAGGCA No data
Right 964767756 3:160195190-160195212 GCTCCAGGCACTGAAATATGGGG No data
964767747_964767756 -4 Left 964767747 3:160195171-160195193 CCCCCACCCAGATTTTTCTGCTC No data
Right 964767756 3:160195190-160195212 GCTCCAGGCACTGAAATATGGGG No data
964767748_964767756 -5 Left 964767748 3:160195172-160195194 CCCCACCCAGATTTTTCTGCTCC No data
Right 964767756 3:160195190-160195212 GCTCCAGGCACTGAAATATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964767756 Original CRISPR GCTCCAGGCACTGAAATATG GGG Intergenic
No off target data available for this crispr