ID: 964767758

View in Genome Browser
Species Human (GRCh38)
Location 3:160195194-160195216
Sequence CAGGCACTGAAATATGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964767752_964767758 -6 Left 964767752 3:160195177-160195199 CCCAGATTTTTCTGCTCCAGGCA No data
Right 964767758 3:160195194-160195216 CAGGCACTGAAATATGGGGCAGG No data
964767749_964767758 -2 Left 964767749 3:160195173-160195195 CCCACCCAGATTTTTCTGCTCCA No data
Right 964767758 3:160195194-160195216 CAGGCACTGAAATATGGGGCAGG No data
964767744_964767758 23 Left 964767744 3:160195148-160195170 CCCCTGTGAAAATAATTCTTGCA No data
Right 964767758 3:160195194-160195216 CAGGCACTGAAATATGGGGCAGG No data
964767750_964767758 -3 Left 964767750 3:160195174-160195196 CCACCCAGATTTTTCTGCTCCAG No data
Right 964767758 3:160195194-160195216 CAGGCACTGAAATATGGGGCAGG No data
964767748_964767758 -1 Left 964767748 3:160195172-160195194 CCCCACCCAGATTTTTCTGCTCC No data
Right 964767758 3:160195194-160195216 CAGGCACTGAAATATGGGGCAGG No data
964767745_964767758 22 Left 964767745 3:160195149-160195171 CCCTGTGAAAATAATTCTTGCAC No data
Right 964767758 3:160195194-160195216 CAGGCACTGAAATATGGGGCAGG No data
964767753_964767758 -7 Left 964767753 3:160195178-160195200 CCAGATTTTTCTGCTCCAGGCAC No data
Right 964767758 3:160195194-160195216 CAGGCACTGAAATATGGGGCAGG No data
964767746_964767758 21 Left 964767746 3:160195150-160195172 CCTGTGAAAATAATTCTTGCACC No data
Right 964767758 3:160195194-160195216 CAGGCACTGAAATATGGGGCAGG No data
964767747_964767758 0 Left 964767747 3:160195171-160195193 CCCCCACCCAGATTTTTCTGCTC No data
Right 964767758 3:160195194-160195216 CAGGCACTGAAATATGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964767758 Original CRISPR CAGGCACTGAAATATGGGGC AGG Intergenic
No off target data available for this crispr