ID: 964768460

View in Genome Browser
Species Human (GRCh38)
Location 3:160200569-160200591
Sequence GAATGAGGGCATTTAGCATT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964768454_964768460 13 Left 964768454 3:160200533-160200555 CCAGCTGTTTGGCTTCAGAAGAC No data
Right 964768460 3:160200569-160200591 GAATGAGGGCATTTAGCATTGGG No data
964768452_964768460 30 Left 964768452 3:160200516-160200538 CCAGGGACTCAGACAGACCAGCT No data
Right 964768460 3:160200569-160200591 GAATGAGGGCATTTAGCATTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964768460 Original CRISPR GAATGAGGGCATTTAGCATT GGG Intergenic
No off target data available for this crispr