ID: 964770955

View in Genome Browser
Species Human (GRCh38)
Location 3:160224636-160224658
Sequence CAATCACTTGTAACCTCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 179}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964770952_964770955 12 Left 964770952 3:160224601-160224623 CCCTTTAGGCGCAAATCAACGCT 0: 1
1: 0
2: 0
3: 0
4: 20
Right 964770955 3:160224636-160224658 CAATCACTTGTAACCTCCTTAGG 0: 1
1: 0
2: 2
3: 5
4: 179
964770953_964770955 11 Left 964770953 3:160224602-160224624 CCTTTAGGCGCAAATCAACGCTC 0: 1
1: 0
2: 0
3: 2
4: 17
Right 964770955 3:160224636-160224658 CAATCACTTGTAACCTCCTTAGG 0: 1
1: 0
2: 2
3: 5
4: 179

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964770955 Original CRISPR CAATCACTTGTAACCTCCTT AGG Intergenic
900956791 1:5891043-5891065 CAATTACTTTTGGCCTCCTTTGG - Intronic
903677313 1:25072541-25072563 CAGTCACTTGCTCCCTCCTTAGG - Intergenic
906013870 1:42555456-42555478 CACTAAATTGTAAGCTCCTTGGG + Intronic
909196734 1:72636209-72636231 AAATCACTTCTAACTTCGTTAGG - Intergenic
911332798 1:96544666-96544688 CAATCACTTTAAATCTGCTTTGG + Intergenic
912107345 1:106295847-106295869 CCATCACTTCTGACATCCTTTGG + Intergenic
916144144 1:161725161-161725183 GAATCAACTATAACCTCCTTAGG - Intronic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
918400712 1:184160011-184160033 AACTCCCTTGTAAACTCCTTGGG - Intergenic
924444574 1:244117199-244117221 AAAACTCTTGTAATCTCCTTGGG + Intergenic
1065487824 10:26251932-26251954 CAATCATTTGTAGCCACCATTGG + Intronic
1066828283 10:39687462-39687484 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066828360 10:39688822-39688844 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066828490 10:39691201-39691223 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066828680 10:39694599-39694621 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066828845 10:39697657-39697679 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066829186 10:39703775-39703797 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066829358 10:39706834-39706856 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066829524 10:39709892-39709914 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066829697 10:39712951-39712973 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066829824 10:39715331-39715353 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066829958 10:39717710-39717732 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066830128 10:39720768-39720790 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066830258 10:39723148-39723170 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066830428 10:39726207-39726229 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066830693 10:39730963-39730985 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066830856 10:39734021-39734043 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066831024 10:39737079-39737101 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066831195 10:39740137-39740159 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066831364 10:39743195-39743217 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066831699 10:39749313-39749335 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066831870 10:39752369-39752391 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066832037 10:39755429-39755451 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066832371 10:39761546-39761568 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066832543 10:39764603-39764625 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066832676 10:39766982-39767004 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066833024 10:39773099-39773121 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066833189 10:39776158-39776180 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066833524 10:39782273-39782295 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066833692 10:39785330-39785352 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066833858 10:39788388-39788410 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066834144 10:39793484-39793506 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066834376 10:39797561-39797583 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066834546 10:39800618-39800640 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066834720 10:39803676-39803698 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066834888 10:39806732-39806754 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066835221 10:39812841-39812863 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066835355 10:39815220-39815242 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066835526 10:39818279-39818301 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066836202 10:39830508-39830530 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066836276 10:39831867-39831889 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066836863 10:39842393-39842415 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066837030 10:39845453-39845475 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066837199 10:39848512-39848534 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066837369 10:39851569-39851591 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066837580 10:39855309-39855331 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066837749 10:39858366-39858388 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066837920 10:39861422-39861444 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066838088 10:39864480-39864502 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066838255 10:39867537-39867559 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066838425 10:39870595-39870617 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066838598 10:39873653-39873675 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066838768 10:39876711-39876733 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066838939 10:39879769-39879791 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066839108 10:39882827-39882849 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066839283 10:39885886-39885908 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066839455 10:39888945-39888967 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066839531 10:39890306-39890328 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066839701 10:39893364-39893386 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066840034 10:39899473-39899495 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066840209 10:39902533-39902555 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066840379 10:39905590-39905612 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066840738 10:39912050-39912072 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066840908 10:39915111-39915133 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066841075 10:39918167-39918189 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066841241 10:39921226-39921248 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066841413 10:39924284-39924306 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066926235 10:41695319-41695341 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066926407 10:41698377-41698399 CAATGACTTGAAATCTCCTCTGG - Intergenic
1066926576 10:41701435-41701457 CAATGACTTGAAATCTCCTCTGG - Intergenic
1073287293 10:102396579-102396601 CAATCCCCTGTGGCCTCCTTCGG - Intronic
1073558346 10:104475375-104475397 CAATCCCTTATAACCTACCTGGG + Intergenic
1077429669 11:2509875-2509897 CTGTCACTTGTCACCTCCATGGG - Intronic
1077537408 11:3131052-3131074 CCCTCACTTGGAACCTCCTGGGG + Intronic
1078226392 11:9395537-9395559 CCCTCACTTGTTACCTTCTTTGG + Intronic
1078662013 11:13295401-13295423 CAGGCACCTGTAACCTCCTCTGG - Intronic
1079411070 11:20188174-20188196 CAACCAAGTGTAACCTACTTTGG + Intergenic
1080209046 11:29764100-29764122 CAAACACTTGGAGCATCCTTTGG - Intergenic
1090698745 11:129275938-129275960 CATTAACTTGTAACCTCCTTTGG + Intronic
1092822644 12:12367346-12367368 CATTCTCTTGTCCCCTCCTTTGG - Intronic
1093585012 12:20824698-20824720 CAATGACATTTAACCTTCTTTGG - Intronic
1094405531 12:30112030-30112052 CAATCAGGTGAAACCTCCTTTGG - Intergenic
1096462990 12:51832985-51833007 CAATCACTTCTCACCACCTCAGG + Intergenic
1098362276 12:69666391-69666413 CAATCACTTCTAACCTACTATGG + Intronic
1101212694 12:102550345-102550367 CAATGATTTGTAACTTCTTTTGG + Intergenic
1106616692 13:31336571-31336593 TAATCTCTTGCAACCTCTTTGGG - Intergenic
1111073583 13:83202559-83202581 TAATCAGTTGTAAGCTACTTGGG - Intergenic
1112628482 13:101134407-101134429 CAATAGATTGTAAACTCCTTAGG + Intronic
1117320476 14:54618032-54618054 CAATCAATTGCAAACTCCTTCGG - Intronic
1120635401 14:86944180-86944202 CAGTCACTTGTTATATCCTTAGG + Intergenic
1122071218 14:99206564-99206586 TAGTCACTAGTAGCCTCCTTGGG + Intronic
1123725373 15:23096164-23096186 CAAGTGCTTGTAACCTCTTTGGG + Intergenic
1126323327 15:47448157-47448179 CACTCACTTGTCACCTTCTATGG + Intronic
1126910525 15:53412693-53412715 GACTCACCTGTCACCTCCTTAGG + Intergenic
1127835007 15:62783647-62783669 CATTCACTTTTAAGCTCCTGAGG - Intronic
1133130395 16:3673048-3673070 CACTCTCTTGTGTCCTCCTTAGG - Intronic
1134289968 16:12896541-12896563 CAATCATCTGTAACATCCCTGGG + Intergenic
1135939330 16:26807296-26807318 TCATCACTTATTACCTCCTTTGG - Intergenic
1137915068 16:52421073-52421095 CAAGCACTTTTCACCTTCTTAGG - Intergenic
1141536682 16:84686304-84686326 CAGTCTCTTGTATCTTCCTTTGG + Intergenic
1146308114 17:31746169-31746191 GAATGACTTGTAACCTTCCTTGG - Intergenic
1147744082 17:42684456-42684478 AAATCAAATGTCACCTCCTTAGG - Intronic
1148257810 17:46151475-46151497 CCATCACTTTCAATCTCCTTAGG + Intronic
1148318372 17:46725154-46725176 AAATCACTTGTCTTCTCCTTTGG - Intronic
1149690356 17:58570585-58570607 CACTCACATGTCACCTCCTCTGG + Intronic
1153799171 18:8654087-8654109 CAATCACTTGATACTTCCATTGG - Intergenic
926861222 2:17311249-17311271 CAATCAGTTGAAACCTACATAGG - Intergenic
927580925 2:24246377-24246399 CAATCATTTGTAATCTCCCTAGG + Intronic
928628390 2:33164767-33164789 CATTCATTTGTCACCTACTTAGG + Intronic
929791887 2:45029379-45029401 CAAGCACTTGTATTCTCCCTGGG - Intergenic
930709650 2:54538439-54538461 TACTCACATGTAACCTCTTTTGG + Intronic
932225067 2:70033178-70033200 CACTCACTTCTCACCTCCTGAGG + Intergenic
934576461 2:95404774-95404796 CCATCACTTGTCATCTCCCTGGG - Intronic
938629761 2:133153926-133153948 GAATCACTTGAACCCTTCTTGGG - Intronic
941202961 2:162537080-162537102 CATTCATTTTTAATCTCCTTAGG - Exonic
941536680 2:166731097-166731119 AAATAACTTATAACTTCCTTTGG - Intergenic
941741379 2:169039016-169039038 CACTTACTGGAAACCTCCTTTGG + Intergenic
942691159 2:178586772-178586794 CAGTCACTTCTAATTTCCTTGGG + Exonic
942853677 2:180520943-180520965 CAATCTCTCTTAACCCCCTTGGG + Intergenic
947912894 2:233813142-233813164 CAATCACTAGCAACTTCCTCTGG + Intronic
1171992613 20:31708359-31708381 CATTCACATGGAACCCCCTTGGG + Intronic
951996627 3:28736789-28736811 AAATCACTTGCCACTTCCTTTGG + Intergenic
953627066 3:44580123-44580145 CAATCACCTGGGACCTCCTGTGG + Intronic
957864506 3:86004798-86004820 CAATGTCTTGTGACCACCTTTGG + Intronic
958100149 3:88998953-88998975 CAATTACTTCTAACATCCCTTGG + Intergenic
962373650 3:134841672-134841694 CAATCATTTGAATCCTGCTTTGG + Intronic
964770955 3:160224636-160224658 CAATCACTTGTAACCTCCTTAGG + Intergenic
966340912 3:178924135-178924157 CAAAGATTTGTAACCTCCCTGGG + Intergenic
970349130 4:15183462-15183484 CACCCACTTTTAACCACCTTGGG - Intergenic
974106952 4:57480464-57480486 CAACCAGTTGTAAGCTCTTTGGG - Intergenic
975414679 4:74092991-74093013 CAGTCTTTTGTAACTTCCTTAGG - Intergenic
975619419 4:76280957-76280979 CAATCACTTGTAACAGGGTTGGG + Intronic
977008407 4:91602970-91602992 CAATCACATGTAATATTCTTGGG + Intergenic
980770678 4:137368787-137368809 GAATCACTTGAAAACTCATTCGG + Intergenic
984205222 4:176779628-176779650 CAATCACTTTTAACCTCCTGAGG + Intronic
988110422 5:26812783-26812805 CTTTCACTCGTCACCTCCTTTGG - Intergenic
990970661 5:61502355-61502377 CAACCATTTCTAACTTCCTTGGG - Intronic
992566418 5:77999408-77999430 CATTCTCTTGTATCCTACTTTGG - Intergenic
995172728 5:109136166-109136188 GAATCACTTGAACCCTACTTGGG + Intronic
998672309 5:144367573-144367595 CTATAAGTTGTGACCTCCTTGGG - Intronic
999135959 5:149319367-149319389 CAATCAAATGTCACCTCCTCAGG - Intronic
999183975 5:149691535-149691557 CAATCACTGGACACCTTCTTGGG - Intergenic
1000434691 5:161193906-161193928 CAATCACTTATGAACTGCTTAGG - Intergenic
1002977866 6:2103179-2103201 CATTCCCTTCTAACCTCATTTGG + Intronic
1004778543 6:18877553-18877575 CACTTAGTTCTAACCTCCTTGGG + Intergenic
1004887166 6:20062318-20062340 CAACCCCTTCTAACCTTCTTTGG - Intergenic
1005082582 6:21971680-21971702 TGCTTACTTGTAACCTCCTTTGG + Intergenic
1005511714 6:26517848-26517870 CCATCACGTCTAGCCTCCTTGGG + Intergenic
1024925818 7:54614317-54614339 CAATCACATGTGGCCTCCGTGGG - Intergenic
1025227854 7:57179739-57179761 CATTGACCTTTAACCTCCTTTGG + Intergenic
1030323414 7:108193837-108193859 CAATCACCTGATACCTTCTTGGG + Intronic
1030732299 7:113004619-113004641 GAAACACTTTTAACTTCCTTGGG + Intergenic
1031056974 7:117002603-117002625 GAATCTCTGGTAACCTCCTAAGG + Intronic
1033358307 7:140619141-140619163 CAAACACTTTTTACATCCTTAGG - Intronic
1033967518 7:146994629-146994651 CAATCACTAGTTACATTCTTGGG - Intronic
1036501955 8:9322249-9322271 CAGGCATTTGTAAGCTCCTTGGG - Intergenic
1037309493 8:17539563-17539585 GAATCACTTGTGACCTCATAGGG + Intronic
1040648708 8:49427129-49427151 CCAGCACTGGTAACCTGCTTGGG + Intergenic
1041945327 8:63434336-63434358 CAATAACTTAAAACTTCCTTCGG - Intergenic
1051651077 9:19325297-19325319 GAATCAATTTTAACTTCCTTAGG - Intronic
1056885239 9:90436175-90436197 AAATCATTGGTAACCTCCTACGG + Intergenic
1056886689 9:90449850-90449872 CAATCACTTGGGCCCTCCTCAGG - Intergenic
1056982517 9:91328158-91328180 CAACCCCTTCTAATCTCCTTGGG + Intronic
1057385957 9:94606264-94606286 CACTAGCTTGTAACCTCTTTAGG + Intronic
1059004282 9:110384242-110384264 CAATCACTCACCACCTCCTTTGG + Intronic
1059956008 9:119516551-119516573 CACTGACTTGTGATCTCCTTTGG + Intronic
1060421284 9:123471443-123471465 CAATCACTTGCCATCTGCTTTGG - Intronic
1187542868 X:20215292-20215314 CAATCATTTCAAACCTCTTTAGG + Intronic
1187739871 X:22343966-22343988 CAAGAACTTGTACCCTGCTTGGG - Intergenic
1189861512 X:45276732-45276754 CAATCACTTGCCACTTCCCTTGG + Intergenic
1192732256 X:73812793-73812815 CAATGGCTTGTATCCTCATTAGG + Intergenic
1192822157 X:74656909-74656931 CAATCACTCATCACCTCCCTTGG + Intergenic
1194193429 X:90864861-90864883 CAATCACTCACCACCTCCTTTGG - Intergenic
1194234869 X:91371388-91371410 CACTCACTTTGAGCCTCCTTTGG - Intergenic
1194264083 X:91734070-91734092 CAATCACTTGCCACCTCCCTTGG + Intergenic
1200540040 Y:4447248-4447270 CAATCACTCACCACCTCCTTTGG - Intergenic
1201965579 Y:19730507-19730529 CAATCACCTATAGCCTCCATTGG - Intronic