ID: 964777375

View in Genome Browser
Species Human (GRCh38)
Location 3:160293009-160293031
Sequence GCAGCTTTATTGGCTGGTAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 227}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964777372_964777375 8 Left 964777372 3:160292978-160293000 CCATCTGGAGAATTTAGGTTTAA 0: 1
1: 0
2: 2
3: 20
4: 205
Right 964777375 3:160293009-160293031 GCAGCTTTATTGGCTGGTAGCGG 0: 1
1: 0
2: 0
3: 20
4: 227

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964777375 Original CRISPR GCAGCTTTATTGGCTGGTAG CGG Intronic
901139412 1:7018805-7018827 GAAGCTTTAATGGCTGGAAAGGG - Intronic
901581901 1:10251442-10251464 AAAGCTTTATTGGCTGGGCGCGG + Intronic
902826309 1:18976705-18976727 GCAGCTTTATTGGCCGGGCACGG + Intergenic
902981679 1:20127837-20127859 ATAGCTTTATTGGCTGGGCGTGG + Intergenic
902982108 1:20131697-20131719 ACAGCTTTATTGACTGGGCGTGG + Intergenic
904713257 1:32447736-32447758 GCAGCATAAGTGGCTGGCAGAGG - Intergenic
905062022 1:35148391-35148413 GCAGCATAAGTGGCTGGCAGAGG - Intergenic
905325342 1:37147844-37147866 GCAGCTCTATTTTCTGGAAGTGG - Intergenic
906467239 1:46093188-46093210 CCAGCTTAATTAGCTGGTACTGG + Intronic
907793596 1:57692336-57692358 GCAGCATAAGTGGCTGGCAGAGG + Intronic
908388524 1:63664795-63664817 GCAGATTCAGTGTCTGGTAGGGG + Intergenic
908777541 1:67655805-67655827 ACAGTTTTAATGGCTGGAAGTGG + Intergenic
909904919 1:81182877-81182899 GCAGCTTGATTGGGTAGGAGGGG + Intergenic
910656090 1:89620082-89620104 GCAGATTTGGTGGCTGGTAAGGG + Intergenic
911129354 1:94373396-94373418 GCAGCATAAGTGGCTGGCAGAGG - Intergenic
911990562 1:104692073-104692095 GCAAAATTATTGGCTGGGAGCGG + Intergenic
913668939 1:121076449-121076471 GCAGCTTTATTATGTGGAAGAGG - Intergenic
914234154 1:145792980-145793002 GCAGCTTTCTGGGAGGGTAGGGG - Intronic
914741591 1:150470596-150470618 GCAGCTTCACTGGCTGGAACTGG - Exonic
915261019 1:154676895-154676917 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
916084097 1:161255812-161255834 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
917354048 1:174107496-174107518 GCTGCTTTCTTGGTAGGTAGAGG - Intergenic
918094076 1:181320378-181320400 GCAGATTTATGGGCTGCAAGGGG - Intergenic
919206701 1:194427420-194427442 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
919257217 1:195140190-195140212 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
919266197 1:195269559-195269581 ACAGCTTGATTGGCTGGGTGTGG - Intergenic
919559130 1:199095946-199095968 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
1063415115 10:5866718-5866740 GCAGCGTAAGTGGCTGGCAGAGG + Intronic
1063992007 10:11576583-11576605 GCAGATTTAATGTCTGTTAGGGG - Intronic
1064603132 10:17013474-17013496 GCAGCATAAGTGGCTGGCAGAGG - Intronic
1064684417 10:17845008-17845030 GTAGCTTTATTAGCTGATAATGG + Intronic
1065483278 10:26215119-26215141 GCAGCTTTGGTGGCTGGTTCAGG + Intergenic
1067113056 10:43414282-43414304 ACAGCTTGATTAGGTGGTAGTGG + Intergenic
1067686867 10:48470998-48471020 GCAACCTTGTTAGCTGGTAGTGG - Intronic
1069907826 10:71742186-71742208 GCAGCTCTATGGGGTGGTACAGG + Intronic
1071060792 10:81569718-81569740 GCAGCTTCCTTGGCTGGCATCGG + Intergenic
1072334553 10:94385798-94385820 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
1072865683 10:99058516-99058538 GAAGCTTTGTTGGCTGGTATTGG - Intronic
1073082437 10:100868541-100868563 GCAGCTTTATTTGCTGTCAGTGG + Intergenic
1073593436 10:104777691-104777713 GCAGCATTATTGGCATTTAGGGG - Intronic
1073821516 10:107269858-107269880 CCAGCTCTATTGGCTGCTTGTGG + Intergenic
1074613227 10:115040674-115040696 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
1076196914 10:128525312-128525334 CCCGCTTTCTTGGCTGGTTGTGG - Intergenic
1077313735 11:1906070-1906092 GCACTTTTAGAGGCTGGTAGAGG - Intergenic
1078734746 11:14009731-14009753 GCAGATTTGTTGTCTGGTAAGGG + Intronic
1078922030 11:15839682-15839704 GCAGCCTTATAGTCTAGTAGGGG - Intergenic
1079591553 11:22189222-22189244 AAAGTTTTATTGGCTGGCAGAGG - Intergenic
1080226110 11:29962526-29962548 GCAACATGATTGGCTGGTAAAGG - Intergenic
1080351746 11:31393001-31393023 GCAGATTTATTGTCTGGTGAGGG - Intronic
1081777341 11:45684652-45684674 GCAGCTTTTCTGGCTGGCAAGGG - Intergenic
1081844519 11:46229873-46229895 ACAGCTTTATTAGCCGGGAGCGG - Intergenic
1084394662 11:68901276-68901298 GCAGCTTAAGTGGCTGGTTCTGG - Intronic
1085357415 11:75851348-75851370 GTTGCTTTATTGGCTGGATGGGG + Intronic
1085469400 11:76747625-76747647 GCAGCTTTCTTGGCTGCTACAGG + Intergenic
1086525975 11:87726412-87726434 GCAGCTTGATTGGCTAGTGGGGG - Intergenic
1086973640 11:93109548-93109570 GCAGCATAAGTGGCTGGCAGAGG - Intergenic
1088291701 11:108245654-108245676 GGAACTTTATTGGCTGGAACTGG + Intronic
1089175085 11:116542687-116542709 ACAGCTTTATTGAGAGGTAGGGG + Intergenic
1092426298 12:8378360-8378382 GCTGCTTTGGTGGCAGGTAGAGG - Intergenic
1093824759 12:23670441-23670463 GCACATTTATTGGCTGAAAGGGG + Intronic
1094727869 12:33141235-33141257 GCAGATTTAGTGTCTGGTAAGGG + Intergenic
1096207548 12:49735532-49735554 GCAGCATAAGTGGCTGGCAGAGG + Intronic
1097428493 12:59474477-59474499 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
1098075555 12:66726624-66726646 GCTGCTTCATTGGTTGATAGAGG - Intronic
1098597738 12:72294012-72294034 GCGGCTTTCATGGCTGGTACTGG + Intronic
1099556811 12:84119154-84119176 GGACATTTATTGGCTTGTAGGGG - Intergenic
1100672717 12:96834583-96834605 GCAGCTTCCTTGGTTGGCAGTGG + Intronic
1102230449 12:111258109-111258131 ACAGCTTTGTAGGCAGGTAGAGG + Intronic
1106379649 13:29223881-29223903 GCAGCTTTCATGGCTGGCACAGG - Intronic
1106757428 13:32836982-32837004 GCAGCTTTGGTGTCTGGTGGGGG + Intergenic
1107171073 13:37342257-37342279 GCAGCTTCCATGGCTGGCAGTGG - Intergenic
1107171337 13:37345638-37345660 GCAGCTTTAGTTGCTGGGAGTGG + Intergenic
1108016917 13:46086066-46086088 GCAGCTTCAATGGCTGGCACCGG + Intronic
1108213573 13:48161690-48161712 TCTGCTTTCTTGGCTTGTAGTGG - Intergenic
1108846147 13:54679928-54679950 GGGGTTTTATTGGGTGGTAGAGG - Intergenic
1108849043 13:54705643-54705665 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
1109218901 13:59620787-59620809 ACTGCTTTTTTGGCTGGTCGTGG - Intergenic
1109982384 13:69924916-69924938 GCAGCTCTATTTGCTGGCACAGG - Intronic
1110653877 13:77974637-77974659 GCAGCATAAGTGGCTGGCAGAGG - Intergenic
1110930123 13:81205206-81205228 CCAGCTTGCTTGCCTGGTAGGGG - Intergenic
1112091539 13:96089840-96089862 GCAGCTTCTCTGTCTGGTAGTGG - Intergenic
1113653768 13:112055994-112056016 TCAGCTTTGTTGGCTCGCAGCGG - Intergenic
1114738119 14:25063839-25063861 GCAGATTTAGTGTCTGGTAAGGG - Intergenic
1115344794 14:32330875-32330897 GCAGCTGTATAGGATGGGAGAGG + Intronic
1122365298 14:101191603-101191625 GCAGCATTATTGCCAGGGAGGGG - Intergenic
1123631723 15:22265658-22265680 GGGGTTTTGTTGGCTGGTAGAGG - Intergenic
1124096612 15:26654434-26654456 GCACCTTTGTTGGCTGGGTGCGG - Intronic
1126660184 15:51025642-51025664 GCAGCTTTACTGTCTGGTCCAGG + Intergenic
1135592484 16:23714218-23714240 GCATATTTATTGGCTGGGCGCGG - Intergenic
1138205774 16:55124026-55124048 GCAGCTTAGTTGGGTGGTTGTGG + Intergenic
1139468935 16:67167992-67168014 GAAGCTTTGTGGGCTGGTAAGGG - Intronic
1140660958 16:77191101-77191123 GGAGCTTTATTGGCTCCTCGCGG - Exonic
1141971268 16:87484749-87484771 GGGGTTTTGTTGGCTGGTAGAGG + Intronic
1142174823 16:88640271-88640293 GCAGCTTTAAGGGCTGGAAGAGG - Exonic
1143781817 17:9233143-9233165 GCAGATTTATGGGCTGCTCGAGG - Intronic
1144014790 17:11183595-11183617 GCAGATGTATTGACAGGTAGTGG - Intergenic
1144085197 17:11802171-11802193 TCTGCTTTATTGGTTGGTAGAGG - Intronic
1144995010 17:19261895-19261917 ACAGTTTTATTGGCTGGGAGTGG + Intronic
1147265504 17:39232019-39232041 GCAGCTGGATTGGGTGTTAGCGG + Intergenic
1147665123 17:42142103-42142125 GCAGATTTATTGGATGGTAATGG - Intronic
1147810452 17:43166280-43166302 GCAGCATAAGTGGCTGGCAGAGG - Intergenic
1152453500 17:80398636-80398658 GCAGCATAAGTGGCTGGCAGAGG + Exonic
1154235426 18:12601128-12601150 ACTGCTTTATTGGCTGGGTGCGG + Intronic
1156327374 18:36086228-36086250 GCAGCTTCCATGGCTGGCAGTGG - Intergenic
1157465465 18:47940677-47940699 TCAGCTTTATTGGCTGGGTGCGG + Intergenic
1157630168 18:49087107-49087129 GCAGATTTAGTGTCTGGTAAGGG - Intronic
1157873294 18:51249570-51249592 GCAAATTTATTGTCTGGTAAGGG + Intergenic
1160907063 19:1456434-1456456 GCAGCTGTCTGGGCTGGAAGGGG + Intronic
1165159651 19:33808528-33808550 GGAGCTTTATGGACTGGGAGGGG + Intronic
1166514353 19:43434961-43434983 TTAGCTTTATTGGCTGGGTGTGG - Intergenic
1167935468 19:52903379-52903401 GCAGCATAAGTGGCTGGCAGAGG - Intergenic
926625501 2:15086350-15086372 GGAGCTTTATTGAGTGATAGAGG - Intergenic
926710336 2:15874538-15874560 GCAGCTGTAGTGACTGGTATGGG - Intergenic
927322321 2:21761900-21761922 GCTGCTTTATTGACTGTTTGTGG + Intergenic
929330678 2:40676625-40676647 GCAGCTTAAGTGGCTGGCAGAGG + Intergenic
931726495 2:65116492-65116514 GAAGCCTAATTGGGTGGTAGTGG - Intronic
935721636 2:105985015-105985037 GCAGCATAAGTGGCTGGCAGAGG - Intergenic
940399390 2:153229831-153229853 GCAGTTTTATAGGATGGCAGAGG + Intergenic
942716011 2:178892909-178892931 GCAGCCTGATTGGGTGGGAGAGG + Intronic
942962910 2:181853861-181853883 CCAACTTTATTGGTTGGTAGTGG + Intergenic
943102889 2:183509355-183509377 GCAGCATAAGTGGCTGGCAGAGG - Intergenic
943281896 2:185945541-185945563 GCAGCTTAGATGGCTGGTATTGG - Intergenic
944770202 2:202906386-202906408 GCAACTTTATTGGCTTGGGGTGG - Intronic
946319003 2:218937836-218937858 GCAGCTTTCTTGTCTGCTAAGGG - Intergenic
947556547 2:231098601-231098623 GCAGCATAAGTGGCTGGCAGAGG - Intronic
1168902200 20:1374533-1374555 GCACCTTTATAGCCTGGTGGTGG + Intronic
1170401119 20:15984883-15984905 GCAGCATAAGTGGCTGGCAGAGG - Intronic
1170578829 20:17682737-17682759 GCAGCTTCCTTGGCTGTTCGCGG - Intergenic
1172736939 20:37133690-37133712 GCAGCTTTAGTAGCTGGGCGTGG + Intronic
1175514012 20:59557294-59557316 GCAGCATAAATGGCTGGCAGAGG - Intergenic
1177781052 21:25622677-25622699 GCAGCTTTCTGGGGTGGTGGGGG + Intergenic
1178825025 21:36007539-36007561 GTAGCTTCACTGGCTGGTAGGGG - Intergenic
1179602481 21:42489396-42489418 GCTGTTTGATTGGCTGGTTGTGG + Intronic
1180178864 21:46108931-46108953 GAAGCTTTATTGAGTGTTAGGGG + Intronic
1181117725 22:20643725-20643747 GCAACTTTTTTGGCTGAAAGAGG + Intergenic
950867005 3:16197278-16197300 GCAGCTTAATTGCTTGGCAGGGG - Intronic
951020916 3:17779810-17779832 GCAGCATAAGTGGCTGGCAGAGG + Intronic
952940532 3:38441043-38441065 GCAGCATAAGCGGCTGGTAGAGG - Intergenic
953622515 3:44545523-44545545 GCAGCATAAGTGGCTGGCAGAGG - Intergenic
954052284 3:47990139-47990161 CCAGCTTAATTGGCCAGTAGAGG - Intronic
954489717 3:50891975-50891997 GCAGCCATATTTGCTGGAAGTGG + Intronic
954599224 3:51854632-51854654 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
954715425 3:52524445-52524467 GCACCTTTATTGTCTGGGACAGG - Exonic
955329177 3:58032775-58032797 ACTGCTTTATTGGCTGGGTGTGG + Intronic
959863570 3:111242250-111242272 GCAGCTTCCTTGGCTGGCACTGG + Intronic
961352200 3:126311168-126311190 GCAGCTGTGGTGGCTGGAAGTGG - Intergenic
961613730 3:128162286-128162308 TCAGCTTTAGTTGGTGGTAGAGG - Intronic
961933033 3:130554210-130554232 GCACATTTCTTGGCTGGTATAGG + Intergenic
962097165 3:132303893-132303915 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
962276913 3:134021531-134021553 GCAGCATAAGTGGCTGGCAGAGG + Intronic
962685457 3:137843271-137843293 GCAGATTTAGTGTCTGGTAAGGG - Intergenic
962767389 3:138578276-138578298 GCAGCTTTTATGGCCGTTAGTGG - Intronic
963940051 3:151088288-151088310 CCAGCTTTACAGGATGGTAGAGG + Intronic
964777375 3:160293009-160293031 GCAGCTTTATTGGCTGGTAGCGG + Intronic
964972417 3:162578122-162578144 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
966060575 3:175749452-175749474 GCAGGTTTAGTGCCTGGTAAGGG + Intronic
967584092 3:191191145-191191167 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
971280757 4:25240969-25240991 GCAGCATAAGTGGCTGGCAGAGG - Intronic
971578879 4:28308438-28308460 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
971827961 4:31652046-31652068 GCAGGTTTAGTGTCTGATAGGGG + Intergenic
972274905 4:37547727-37547749 GCAGCATAAGTGGCTGGCAGAGG + Intronic
976174135 4:82335422-82335444 GCAGCATAAGTGGCTGGCAGAGG - Intergenic
976257314 4:83111900-83111922 GCAGCTGTATCGGCTGGGTGTGG + Intronic
976511015 4:85910146-85910168 GCAGCTTCACTGGCTGGCACCGG + Intronic
978223801 4:106309590-106309612 GGAGCCTTATTGGCTGGGTGTGG - Intronic
978247367 4:106590211-106590233 GCAGCTTTGTTGGCCAGTCGAGG - Intergenic
980952161 4:139391747-139391769 ACAGCATTATTGGCTGGGTGCGG - Intronic
981709542 4:147695543-147695565 GCAGCTTTGGTGTCTGGTAAGGG + Intergenic
981745944 4:148052539-148052561 GCATCTTTCTTGGTTAGTAGGGG + Intronic
982699172 4:158639962-158639984 GCAGATTCAGTGTCTGGTAGGGG - Intronic
983180804 4:164646274-164646296 GCAGATTTAATGTCTGGTAAGGG - Intergenic
986933591 5:12855884-12855906 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
986961367 5:13217425-13217447 GCAGATTCATTGTCTGGTAAGGG - Intergenic
987421306 5:17723665-17723687 TCAACTATATTGGCTTGTAGAGG - Intergenic
989132201 5:38118573-38118595 CCAGCTTTATAGGCTGGAGGAGG + Intergenic
989496601 5:42116274-42116296 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
990267830 5:54097351-54097373 GCAGTGTTATTGGCTGGTTGTGG - Intronic
991605393 5:68395951-68395973 GCTGCTTCAGTGGCTGCTAGGGG - Intergenic
991633366 5:68679270-68679292 GAAGGTTTTTAGGCTGGTAGAGG - Intergenic
991954744 5:71983413-71983435 GCAGCTTTATTTGCAAGAAGTGG - Intergenic
992455609 5:76912778-76912800 GCAGCATAAGTGGCTGGCAGAGG + Intronic
993191824 5:84692989-84693011 GCACCTTTATAGGCTGTAAGAGG + Intergenic
994454429 5:99986034-99986056 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
994530521 5:100964264-100964286 ACAGCTTTTTTGGGGGGTAGGGG - Intergenic
995902575 5:117087489-117087511 GCTTATTCATTGGCTGGTAGCGG + Intergenic
996306702 5:122055151-122055173 GCAGATTTAGTGTCTGGTAAGGG + Intronic
998028285 5:138840008-138840030 GCAGCTTTCTTGGCTGGAATTGG + Intronic
998098464 5:139412098-139412120 GGGGCTTTAGTGGCTTGTAGGGG - Exonic
999334828 5:150706476-150706498 GCTGCTTGGTAGGCTGGTAGCGG + Intergenic
1000860406 5:166450310-166450332 GCAGCTTTGTTTACTGGGAGAGG + Intergenic
1000883340 5:166721859-166721881 GCCTCTTCATTGGCTGGAAGTGG - Intergenic
1001558673 5:172655046-172655068 GCAGCCTAAGTGGCTGGCAGAGG - Intronic
1004812661 6:19276634-19276656 GCAGCGTAAGTGGCTGGCAGAGG + Intergenic
1004838257 6:19553188-19553210 GCAGCTGTCTAGGCTGGTATAGG - Intergenic
1004923071 6:20395118-20395140 GAAGCTCTATTGGCTGTTTGGGG - Intergenic
1007575253 6:42921390-42921412 GAAGCTTTGTTGGCTGGGTGCGG - Intronic
1008123269 6:47641691-47641713 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
1010056115 6:71567125-71567147 GCAGATTTAGTGGCTGGTGAGGG - Intergenic
1010308146 6:74349252-74349274 GCAGATTTAATGTCTGGTAAGGG + Intergenic
1010317722 6:74469589-74469611 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
1010339589 6:74732613-74732635 GCAGATTTGGTGGCTGGTGGTGG - Intergenic
1011259150 6:85453698-85453720 GCAGCCTTATGGGCAGGAAGTGG - Intronic
1011686188 6:89825639-89825661 GCAGATTTATTGTCTGGTGAGGG - Intergenic
1011927558 6:92666304-92666326 GCAGCTTTTCTTGTTGGTAGTGG - Intergenic
1012299452 6:97566688-97566710 GCAGCTTTATAGCTAGGTAGTGG - Intergenic
1013559323 6:111289166-111289188 GCAGCATAAGTGGCTGGCAGAGG - Intergenic
1014336449 6:120142610-120142632 GCAGCTTTGGTGGCTGGTTAGGG - Intergenic
1015896394 6:138021061-138021083 GCAGCTTTACTCAATGGTAGTGG + Intergenic
1020116196 7:5477888-5477910 GGAGCTTCATTGGCCGGCAGGGG + Intronic
1021756323 7:23856683-23856705 GCAGCATAAGTGGCTGGCAGAGG - Intergenic
1023077798 7:36501140-36501162 GCAGCATAAGTGGCTGGCAGAGG - Intergenic
1023988882 7:45116049-45116071 GCAGCTTCAGTGTCTGGTAAGGG - Intergenic
1029485951 7:100840533-100840555 GCAGCATAAGTGGCTGGCAGAGG + Intronic
1034579554 7:152030859-152030881 GCAGCATAAGTGGCTGGCAGAGG - Intronic
1035747259 8:1971256-1971278 ACAGCTTTATTGGCTGGGGGAGG + Intergenic
1037219085 8:16495395-16495417 GCAGATTCATTGTCTGGTAGGGG - Intronic
1039877037 8:41595872-41595894 GCAGCATAAGTGGCTGGCAGAGG - Intronic
1041074790 8:54159603-54159625 GCAGATTAATAGGCTGGGAGTGG - Intergenic
1043613434 8:82094028-82094050 GCAGCATAAGTGGCTGGCAGAGG - Intergenic
1046913843 8:119658943-119658965 GCAGCTTTATTCTCTGTCAGTGG + Intronic
1048445905 8:134493209-134493231 GCAGCTGTGTTGGCCGGTAGTGG - Intronic
1048926954 8:139280022-139280044 GCAGCCTTATTGTCTGGTTTGGG + Intergenic
1049438703 8:142599436-142599458 GCAGGTTTGTTGGCCGGGAGAGG - Intergenic
1050377724 9:4990375-4990397 GCAGTGTTAGTAGCTGGTAGAGG + Intronic
1051188566 9:14486535-14486557 TCAGTTTTAATGACTGGTAGGGG + Intergenic
1054760128 9:68997437-68997459 GCAGCATCTTTGGTTGGTAGGGG - Intronic
1055140879 9:72875786-72875808 GTAGCTTCACTGGCTGGAAGAGG + Intergenic
1055759480 9:79591387-79591409 CCAGCTTTATTGAGTGGTAGAGG + Intronic
1056697829 9:88875051-88875073 TCAACTTTATTGGCTGGGCGCGG + Intergenic
1059422168 9:114199081-114199103 GCAGCCTTCTTGGCTAGTGGAGG - Intronic
1060650297 9:125319886-125319908 ACAGGTTTTTTGGCTGGGAGCGG - Intronic
1060709939 9:125851199-125851221 GCAAATTTATTAGCTGATAGAGG - Intronic
1060981186 9:127793205-127793227 GCAGCTTAATTGGCTGGGCCTGG - Intergenic
1185540076 X:896318-896340 GCAGATTTATTGGCTGGAGGGGG - Intergenic
1187973299 X:24680173-24680195 GCAGATTTAGTGTCTGGTGGGGG - Intergenic
1188097934 X:26045519-26045541 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
1188136917 X:26502884-26502906 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
1188220626 X:27537032-27537054 ACATTTTTATTGGCAGGTAGAGG + Intergenic
1188767609 X:34115408-34115430 GCAGAATTCTAGGCTGGTAGGGG + Intergenic
1189034330 X:37480073-37480095 GCAGCATAAGTGGCTGGCAGAGG + Intronic
1190771010 X:53513982-53514004 GCAGCATAAGTGGCTGGCAGAGG + Intergenic
1194752266 X:97698163-97698185 GCAGATTTAGTGTCTGGTAAGGG + Intergenic
1194752329 X:97698813-97698835 GCAGATTTAGTGTCTGGTAAGGG - Intergenic
1198891853 X:141405077-141405099 GCAGATTCATTGTCTGGTAAGGG - Intergenic
1200694723 Y:6348954-6348976 GCAGCATAAGTGGCTGGCAGAGG - Intergenic
1200707514 Y:6455554-6455576 GTAGCTTTATTTGCAGGCAGAGG + Intergenic
1201026598 Y:9709154-9709176 GTAGCTTTATTTGCAGGCAGAGG - Intergenic
1201040554 Y:9825756-9825778 GCAGCATAAGTGGCTGGCAGAGG + Intergenic