ID: 964777825

View in Genome Browser
Species Human (GRCh38)
Location 3:160298042-160298064
Sequence GTGAATAGGGAGAAGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 515
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 477}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964777821_964777825 8 Left 964777821 3:160298011-160298033 CCACACTAATATCATAGCATATC 0: 1
1: 0
2: 1
3: 4
4: 104
Right 964777825 3:160298042-160298064 GTGAATAGGGAGAAGAAGGCAGG 0: 1
1: 0
2: 2
3: 35
4: 477

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964777825 Original CRISPR GTGAATAGGGAGAAGAAGGC AGG Intronic
900738562 1:4316203-4316225 GTGCATAGAGAGAAGACAGCTGG + Intergenic
900865000 1:5262399-5262421 GAGAATTGGGAGAAGAACCCAGG - Intergenic
901258990 1:7857271-7857293 GTGAGTAGGGAGAGGAAGGAGGG - Intergenic
902278806 1:15359416-15359438 GTGAGGTGGGAGCAGAAGGCGGG + Intronic
902535831 1:17118932-17118954 GTGAAAGGGGAGAGGACGGCAGG + Intronic
903294045 1:22332446-22332468 GAGACTTGGGAGGAGAAGGCTGG - Intergenic
903797450 1:25940422-25940444 GTGAAGAGTGAGACAAAGGCTGG + Intergenic
903974134 1:27138184-27138206 GTGAGAATGGAGAAGAGGGCAGG - Intronic
904895815 1:33817279-33817301 GAAAAAAGAGAGAAGAAGGCAGG + Intronic
906303787 1:44703345-44703367 GTGAATGGGGAGAGGGAGGGAGG - Intronic
907620487 1:55972987-55973009 GGGAATAGTGAGAAAAAGGCTGG + Intergenic
908387623 1:63657625-63657647 GTGAAAAGGGAGAAGCAGGGAGG - Intronic
909267867 1:73584799-73584821 GTGAAGAGGGAGAATAAAGATGG + Intergenic
909412342 1:75369311-75369333 GTAAATAGTAAGAAGAAGCCAGG - Intronic
909578351 1:77202486-77202508 GTGACTAGGAAGAAAATGGCTGG + Intronic
910261728 1:85299540-85299562 GGGGATAGAGAGAGGAAGGCAGG + Intergenic
910289587 1:85587540-85587562 GTGAATGGTAAGAAGTAGGCAGG - Intergenic
910408359 1:86914410-86914432 GTAAACTTGGAGAAGAAGGCGGG - Exonic
912826118 1:112905063-112905085 GTGCAGAGGGAAAAGAAGGGCGG + Intergenic
912961013 1:114196127-114196149 ATGAAAAGGGAGAAGAAGTTGGG + Intergenic
913224605 1:116687788-116687810 GTGAAGAGAGAAAAGAAGACTGG + Intergenic
914806754 1:150997455-150997477 GAGAGTAGGGAGAGGAAGACAGG + Intronic
914868499 1:151453214-151453236 GCGAAAAGGGAGAAAGAGGCTGG - Intronic
915240990 1:154521578-154521600 CTGACTGTGGAGAAGAAGGCAGG + Intronic
916062468 1:161109652-161109674 GTAAATAAGGAGACCAAGGCTGG + Intronic
916116253 1:161487433-161487455 GTGATTACGGACAAGAAAGCAGG + Intergenic
916270809 1:162939354-162939376 GTGAATGTGGAGAAGTAGGAAGG + Intergenic
916490812 1:165300824-165300846 ATGAATGAGGAGAAGCAGGCAGG - Intronic
916552911 1:165866030-165866052 GGGAATAGGGAGAGGAAGAAGGG + Intronic
917616732 1:176753469-176753491 GAGCAGAGGAAGAAGAAGGCTGG - Intronic
917815485 1:178705651-178705673 GTGAAAAGTGAGAATGAGGCCGG - Intergenic
918662389 1:187105989-187106011 AGAAATAGGGAGAAAAAGGCTGG + Intergenic
919221450 1:194634687-194634709 GTGAATGGATAGCAGAAGGCTGG - Intergenic
919279303 1:195466540-195466562 GTGATTAGGGAGACTAAGGAGGG - Intergenic
919853812 1:201692191-201692213 GTGGATATAGAGAAGCAGGCAGG + Intronic
920963890 1:210686494-210686516 GTGAGTAGGCAGAAGAAAGTTGG - Intronic
921293168 1:213677653-213677675 GTAATTAGGGAGAAGAATGCTGG + Intergenic
921719252 1:218452287-218452309 ATGATTAGGGAGAAGAAGAATGG - Intergenic
921835442 1:219773376-219773398 GGGAATGGGAAGCAGAAGGCTGG + Intronic
922630266 1:227100271-227100293 GTGAAGTGGGAGGAGCAGGCTGG - Intronic
923482159 1:234395745-234395767 ATGAAGAGTGAGAAGAAGACTGG + Intronic
923490880 1:234483019-234483041 GTGAAGATGGAGAATTAGGCAGG - Intergenic
924318732 1:242825626-242825648 GTGTCTAGGGAGAAGAAGCTTGG - Intergenic
924539891 1:244970740-244970762 GGGAAGAGGGTGAAGAGGGCGGG - Exonic
924837816 1:247672152-247672174 CAGAATAGGGAGATGCAGGCAGG - Exonic
1063629631 10:7721745-7721767 GTGAAAAGAGAAGAGAAGGCTGG + Exonic
1063914200 10:10864794-10864816 GTGAATATGGGGATGAAAGCTGG - Intergenic
1063976681 10:11423375-11423397 GAGAAGGGGGAGAGGAAGGCTGG - Intergenic
1064212217 10:13369645-13369667 TTGAAAAAGGAGTAGAAGGCCGG + Intergenic
1064490562 10:15851377-15851399 GTGAAGAGGGAGATGCAGGCAGG - Intronic
1065963638 10:30753838-30753860 GTGAATAAGAAAAGGAAGGCAGG - Intergenic
1066306609 10:34150394-34150416 TAGAATATGGAGAAGAGGGCTGG + Intronic
1067009605 10:42698043-42698065 GAGAAGAGGGAGAAGAAGAAGGG - Intergenic
1067394613 10:45903039-45903061 GTGAAGGGGGAGAAGAAAGATGG + Intergenic
1067682211 10:48448331-48448353 GTTAAAAGGGAGATGAAGGAGGG - Intronic
1067781694 10:49212412-49212434 GGGAGTAGGGAGAGGGAGGCAGG - Intergenic
1067862936 10:49872170-49872192 GTGAAGGGGGAGAAGAAAGATGG + Intronic
1071829340 10:89356214-89356236 GTGAGTAGGGGGAGGAAGGGTGG + Intronic
1072834279 10:98694746-98694768 GTGGATAGGGAGAAGGAGATAGG - Intronic
1073447171 10:103588648-103588670 GTTAAAAAGGAGAGGAAGGCCGG + Intronic
1075193341 10:120331573-120331595 GGGAATAGGGAGAAGAAGAGAGG - Intergenic
1075618038 10:123905670-123905692 GTGAATAGGGAGAAGCTGCGTGG - Intronic
1077759443 11:5076281-5076303 GTGAGAAACGAGAAGAAGGCTGG + Intergenic
1077795715 11:5489475-5489497 GTGAGGAAGGAGAAGAAGGCAGG - Exonic
1077819927 11:5727264-5727286 GTAAAAAAGGAGAAGAGGGCTGG - Intronic
1078841500 11:15079786-15079808 GGGAATAAAGAGAAGAAGGGAGG + Intronic
1079489128 11:20967882-20967904 ATGAATTTGGAGAAGTAGGCAGG - Intronic
1083372397 11:62192639-62192661 TTGAACAGGGAGAAGAAGGCAGG + Intronic
1083378285 11:62243876-62243898 TTGAACAGGGAGAGGAAGGCAGG + Intronic
1084616683 11:70240991-70241013 GTGAAATGGGTGAAGAGGGCAGG - Intergenic
1085082074 11:73643542-73643564 GTGATTTGGGAGGTGAAGGCAGG - Intergenic
1086381749 11:86261964-86261986 ATTAATAGGGAAGAGAAGGCAGG - Intronic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1087597925 11:100276997-100277019 GTAAATAGAGAGTAGAAGGTTGG - Intronic
1088003752 11:104915451-104915473 GTGAATACTGAAAAGTAGGCTGG - Intergenic
1088007511 11:104960807-104960829 GTGGATAGAGATAAGTAGGCTGG - Intronic
1090033042 11:123223775-123223797 GTGAATTGGGAGGCCAAGGCGGG + Intergenic
1090103520 11:123827413-123827435 GTGAATAATGAAATGAAGGCAGG - Intergenic
1091800719 12:3323054-3323076 GAGAGGAGGGAGAAGAAGGAAGG + Intergenic
1092051563 12:5474503-5474525 GTGCACAGGGAGAGGAGGGCTGG + Intronic
1092174066 12:6390946-6390968 GAGAAAAGGCAGAAGAAGGGGGG + Exonic
1092382848 12:8012004-8012026 GTGATTTGGGAGAACAAGGAGGG + Intergenic
1092726192 12:11487916-11487938 GTGAAAAGGCAGAGGCAGGCTGG - Intronic
1092732236 12:11545723-11545745 ATGAATGAAGAGAAGAAGGCAGG - Intergenic
1092735622 12:11579775-11579797 CTGAACTGGGAGAAGAAGGGTGG - Intergenic
1092737157 12:11593355-11593377 AGGAGTAGGGAGGAGAAGGCAGG + Intergenic
1095828763 12:46560181-46560203 ATGAAAATGGAGAAGAAGGCAGG + Intergenic
1096633402 12:52943987-52944009 GTGAGCAGGGAGCAGAAGGCTGG + Intronic
1097711239 12:62919882-62919904 GGGAATGGGGAGAAGAGGACAGG + Intronic
1097914764 12:65009153-65009175 GGGAGGATGGAGAAGAAGGCAGG - Intergenic
1097984835 12:65772035-65772057 GTGAATAGGAGGAAGAAGCAGGG - Intergenic
1098191430 12:67953250-67953272 GGGAGGAGGGAGAAGGAGGCTGG + Intergenic
1098300154 12:69046015-69046037 GTGCTTCGGGAGAACAAGGCAGG - Intergenic
1098353005 12:69583398-69583420 TTGGATGGGGAGAAGGAGGCAGG - Intergenic
1099002854 12:77201321-77201343 GTGGCTAGGGAGAAGGAGGCAGG + Intergenic
1099217355 12:79869198-79869220 GTGAATAGGTAGATGAATGATGG - Intronic
1100118132 12:91334626-91334648 GAGGAGAGGGAGAAGAAGGGAGG + Intergenic
1100892078 12:99136740-99136762 GGGAACAGGGAGAAGAATGCAGG + Intronic
1101302204 12:103494808-103494830 GTGAATAGGGTAAAGAAGGGAGG + Intronic
1101727025 12:107396160-107396182 GTGGAGAGGCAGAGGAAGGCTGG - Intronic
1102558900 12:113748290-113748312 CTGAAGAGGGAGAAGAAACCTGG - Intergenic
1102565543 12:113794991-113795013 CTGAATAGGGGGAAGGAGGGAGG + Intergenic
1103954340 12:124567898-124567920 GAGAAGAGGGAGGGGAAGGCTGG - Intergenic
1104400660 12:128473335-128473357 GTGAAGATGAAGAAGGAGGCTGG - Intronic
1104534951 12:129609971-129609993 GTGAAAAGAGAGGGGAAGGCTGG + Intronic
1105249483 13:18685074-18685096 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1106824164 13:33501322-33501344 GTGAATAGGGAGGCCAAGGCAGG - Intergenic
1107424317 13:40277467-40277489 GTGCATATGGAGAATAATGCAGG - Intergenic
1107615707 13:42164986-42165008 GGGAAAAGGAAGAAGAAGGACGG - Intronic
1107743002 13:43473699-43473721 GTTAATAGGGAAGAGAAAGCTGG + Intronic
1107999375 13:45892390-45892412 GGGCACAGGGAGATGAAGGCAGG - Intergenic
1108834401 13:54523293-54523315 GAGAAAAGGGAGAGGAAGGCAGG - Intergenic
1108967942 13:56335570-56335592 TGGAATAGGAAGACGAAGGCTGG - Intergenic
1112782624 13:102917333-102917355 GTAAATAGGAAGATGAAGGAAGG - Intergenic
1112873371 13:104002775-104002797 GTGAAAAGGGAGAAAATGACTGG - Intergenic
1113282121 13:108799860-108799882 GTTAAGAGGAAGAAGAAGGGAGG + Intronic
1113322193 13:109244895-109244917 GTGAGTAAGGAGAAGAATGTTGG + Intergenic
1113398185 13:109968371-109968393 TGGAAAAGGGAGAAGAAGCCGGG + Intergenic
1113674010 13:112195917-112195939 ATGAAGAGAGAGAGGAAGGCAGG - Intergenic
1113674102 13:112196299-112196321 ATGAAGAGAGAGAGGAAGGCAGG - Intergenic
1113879898 13:113619170-113619192 GTGAATAGAAACAAGAAGCCCGG + Intronic
1114424889 14:22613240-22613262 TTTTATAGGGAGGAGAAGGCAGG + Intergenic
1114491159 14:23102889-23102911 ATGAATAGGGAGAAGCAAACAGG - Intergenic
1114512351 14:23273021-23273043 GTGAATAGGGTAAAGATGGGGGG - Exonic
1114895870 14:26990618-26990640 TAGAATAGGGAGAAGAAGGAAGG + Intergenic
1115175359 14:30556138-30556160 TTGAATAGGAAGAGGAAAGCAGG + Intergenic
1115447038 14:33502453-33502475 GTGAACAGAGAGCAGAAGTCGGG - Intronic
1115532453 14:34339844-34339866 GTTAAGAGGGAAAAGTAGGCCGG - Intronic
1116915710 14:50523595-50523617 CTGAATGGAGTGAAGAAGGCAGG - Intronic
1117652459 14:57921265-57921287 ATGCAGAGGGATAAGAAGGCAGG + Intronic
1118127243 14:62920212-62920234 AGGGATAGGGAAAAGAAGGCAGG + Intronic
1118503085 14:66381718-66381740 GTGAAAAGGGAAAAGTGGGCAGG - Intergenic
1119063759 14:71504435-71504457 GAGAATAGAGAGAGGAAAGCTGG - Intronic
1119210000 14:72824402-72824424 ATGAACAGGGAGGAGAAGGGGGG - Intronic
1119838934 14:77776302-77776324 TTGAATAAGGAGAACAAGGTGGG - Intergenic
1120249393 14:82043916-82043938 GTGAATAGGGTAAAGAATGTAGG + Intergenic
1120254613 14:82103289-82103311 TTGAATAGGGCAAAGAAGGATGG + Intergenic
1120963960 14:90151007-90151029 GTGAACAGGAGGAAGAAGGGAGG - Intronic
1121092377 14:91191564-91191586 GGGAACAGGGAGAATGAGGCTGG - Intronic
1121512279 14:94521466-94521488 GACAGTAGGGAGAAGTAGGCAGG + Intergenic
1122271575 14:100570675-100570697 GTGGCTAGGGAGAAGATAGCAGG + Intronic
1122415209 14:101546259-101546281 GGGAACAGGGAGAAGAAGCGGGG + Intergenic
1122804749 14:104250647-104250669 GTGAAAAGGGGGAAGGAGGGAGG + Intergenic
1122927549 14:104913223-104913245 ATAATTAGGGAAAAGAAGGCCGG + Intergenic
1125182695 15:36895522-36895544 TTGATTAGGGGGACGAAGGCTGG + Intronic
1125310963 15:38377789-38377811 GAGAAGAGGAAGAGGAAGGCTGG + Intergenic
1125907799 15:43409460-43409482 GTGTATAGGGAAGAGAAGGTAGG - Intronic
1125933604 15:43616695-43616717 GTGCAGAGGGAGGAGCAGGCAGG + Intronic
1125946702 15:43716157-43716179 GTGCAGAGGGAGGAGCAGGCAGG + Intergenic
1126298837 15:47172032-47172054 GTGAATAGGTAGAATAAAGAGGG - Intergenic
1126451470 15:48813369-48813391 GTAAGTCTGGAGAAGAAGGCAGG + Intergenic
1126820601 15:52499934-52499956 GTGCTTTGGGAGAACAAGGCAGG + Intronic
1126874519 15:53025604-53025626 GTAAATAGAGAGTAGAAGGATGG - Intergenic
1126907901 15:53387083-53387105 GTGTTAAGGGAGAAGCAGGCTGG + Intergenic
1126950718 15:53877591-53877613 GAGAATAGGGAGGAGGAGGAGGG + Intergenic
1128223216 15:65982982-65983004 GGGAAGAGGGAGAAGCGGGCAGG - Intronic
1128741482 15:70086867-70086889 GTGCAAAAGGGGAAGAAGGCAGG - Intronic
1130766650 15:86877846-86877868 GTGAGAAGAGAGAAGAAGGTTGG - Intronic
1131955955 15:97736478-97736500 GGGGGTAGGGAGAAGAGGGCAGG + Intergenic
1132159116 15:99520729-99520751 GTAATTTGGGAGACGAAGGCAGG + Intergenic
1133797778 16:9060175-9060197 TTAAATATGGAGAAGAAGGAAGG + Intergenic
1133978770 16:10618703-10618725 GTGAACTGGGGGAAGAAGGGAGG + Intergenic
1134087972 16:11371702-11371724 GTGAATGGGAACAAGAAGGTTGG - Intronic
1134821913 16:17253799-17253821 GTTGCAAGGGAGAAGAAGGCAGG - Intronic
1134856040 16:17520112-17520134 ATGAAGATGGAGAAGGAGGCAGG + Intergenic
1135523585 16:23196365-23196387 ATGAGGAGGGAGAAGTAGGCAGG + Intronic
1137316013 16:47323878-47323900 GAGAACAGGGAGAGGAAGACGGG + Intronic
1137828013 16:51516593-51516615 TTAAAAAGGGAAAAGAAGGCTGG - Intergenic
1138845626 16:60562241-60562263 CTGAATATGGAATAGAAGGCAGG + Intergenic
1138913468 16:61431845-61431867 ATGAAAGTGGAGAAGAAGGCCGG - Intergenic
1139317620 16:66087076-66087098 GAGAATAGAGAAAAGAAGGGTGG + Intergenic
1139640882 16:68290639-68290661 GGGAGTAGGGAGAAGAGGGGAGG - Intronic
1139811733 16:69624605-69624627 GTGGATAGGGATAAGGAGGAAGG - Intronic
1140026740 16:71297662-71297684 GAGAGTGGGGAGAGGAAGGCAGG - Intergenic
1140928491 16:79605649-79605671 GTGAAGAAAGAGAAGAAGGCTGG - Intergenic
1141060280 16:80860672-80860694 GTGCATTGGGAGGTGAAGGCAGG + Intergenic
1141761677 16:86032857-86032879 GTGTATTTGGAGAAGAAGCCTGG + Intergenic
1142108695 16:88319623-88319645 GTGGATGGGGAGGAGAAGGGTGG - Intergenic
1142788190 17:2241987-2242009 GTGCACAGTGGGAAGAAGGCAGG + Intronic
1143082080 17:4389199-4389221 TTGAATGGGCAAAAGAAGGCGGG + Intergenic
1143319616 17:6059627-6059649 GGGAGCAGGGAGAGGAAGGCGGG + Intronic
1143329380 17:6122106-6122128 CTGCATTGGGAGGAGAAGGCAGG + Exonic
1143347956 17:6263779-6263801 ATCAAAAGGGAGAAGAAGACTGG + Intergenic
1144453881 17:15403422-15403444 GAGAATAGGGAGAGGGTGGCTGG - Intergenic
1144467713 17:15509544-15509566 GTTAATAGGCAGAGGAAGGATGG - Intronic
1145760592 17:27423280-27423302 GGGAATGCGGAGAGGAAGGCTGG + Intergenic
1146081083 17:29781105-29781127 TTAAAAAGGGAGAAAAAGGCCGG - Intronic
1146160628 17:30557597-30557619 GGGAATGGGGAGAACAAGGCTGG + Exonic
1146843763 17:36171218-36171240 GGGAATGGGGAGAGCAAGGCTGG - Intronic
1147018662 17:37512918-37512940 GTGGAGAGGGAGCAGACGGCGGG - Exonic
1147367873 17:39971172-39971194 GTGAAGAGGAAGAAGGAGCCAGG + Intronic
1147467078 17:40618500-40618522 GTTACTAGGGAGAATGAGGCAGG + Intergenic
1147479065 17:40741759-40741781 GTGGAAGGGGAGAAGAAAGCAGG + Intergenic
1147680018 17:42236912-42236934 GTAAATAAGCAGAAGATGGCGGG - Intronic
1148003810 17:44408496-44408518 GTGGCTAGAGAGAAGATGGCAGG - Intronic
1148621784 17:49039964-49039986 GTGCATAGGAAGGAGAACGCAGG + Exonic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148794394 17:50190129-50190151 GTGAATGGAGGGAAGGAGGCAGG + Intronic
1149033208 17:52106391-52106413 TTGAATAGGGAGGAAAAGGGAGG + Intronic
1149846918 17:60013703-60013725 GGGAATGGGGAGAGCAAGGCTGG - Intergenic
1150035057 17:61786128-61786150 GTGAAGAGAGAGAAGAAAGAAGG + Intronic
1151752719 17:76050031-76050053 CTGCAAAGGGAGAAGAAGGTGGG + Intronic
1153232542 18:2953156-2953178 TGGAATAGGGAGAAAAAGGCTGG + Intronic
1154024544 18:10695295-10695317 GAGGCTGGGGAGAAGAAGGCTGG + Intronic
1154439350 18:14373827-14373849 AGGAATAGGGAGAAAGAGGCAGG + Intergenic
1155676124 18:28430959-28430981 GTTACTAGGGAGAAAAAGGCAGG - Intergenic
1156605238 18:38658438-38658460 CTGAATAGGGAGCATAAGGGTGG + Intergenic
1159080365 18:63729473-63729495 GGGACTAGGGAGAGGAAGGGAGG + Intergenic
1159134887 18:64326253-64326275 GTGAAAAGGGAAAAAAAGGGGGG + Intergenic
1159751555 18:72308532-72308554 CTGATAAGGGAGAAGAATGCAGG + Intergenic
1160293530 18:77617093-77617115 CTGAAAAGTGGGAAGAAGGCAGG - Intergenic
1161517376 19:4703954-4703976 TTGATGAAGGAGAAGAAGGCAGG + Exonic
1161874233 19:6895199-6895221 GTGAAAAGGGAGAAAAAGTGTGG + Intronic
1162180814 19:8867531-8867553 GTGAATGGGGAGGAGAATGGGGG + Intronic
1162181283 19:8870812-8870834 GTCAATGGTGAGAAGAAAGCAGG + Intronic
1162292823 19:9792280-9792302 GTGAAGGGAGAGAAGAGGGCGGG - Intronic
1163413192 19:17169728-17169750 GTGAAGAGGAAGAGGGAGGCAGG - Intronic
1163527477 19:17830458-17830480 GCGTGGAGGGAGAAGAAGGCTGG + Intronic
1163610122 19:18296291-18296313 GTGAGTGGGGAGAAGAAGAGGGG - Intergenic
1163786758 19:19278819-19278841 GAGAAGAGGGAGAAGCAGGAAGG + Intronic
1164441118 19:28281691-28281713 ATGAAGAGGGAGAAGAGGGTGGG - Intergenic
1164441259 19:28282346-28282368 GAGAATGGGGAGAAAATGGCAGG - Intergenic
1164821033 19:31251432-31251454 GTCACTAGGGAGCAGGAGGCAGG - Intergenic
1165333151 19:35152592-35152614 GTGAGGATGGAGAAGAAAGCTGG + Intronic
1165472803 19:36013305-36013327 GTGCAGAGGGTGAAGGAGGCAGG - Intronic
1165997296 19:39853284-39853306 TTGAAAAGGGAGGAGAGGGCCGG + Intergenic
1167036150 19:46996058-46996080 GTGCATATGCAGAAGGAGGCTGG + Intronic
1167067453 19:47197208-47197230 GGGAATAAGAAAAAGAAGGCAGG - Intronic
1167495159 19:49813245-49813267 TTGAGTTGGGTGAAGAAGGCGGG - Exonic
1168458737 19:56537010-56537032 GTGAATAGGGAGAAGGGGGGTGG + Intergenic
925363318 2:3294730-3294752 GTGTATAGAGAGAGGATGGCTGG - Intronic
926824844 2:16895014-16895036 ATAAATAGGAAGTAGAAGGCAGG + Intergenic
927826297 2:26312197-26312219 GAGAAAAGGGAGAGGAAGACAGG + Intronic
927937584 2:27084316-27084338 ATGAACAGGGAGAAGATGGATGG - Intronic
928403518 2:30996554-30996576 GTGAATAGAGAGTAGAGGGGGGG - Intronic
928690029 2:33789687-33789709 GGGTATAGGGAGAAAAGGGCAGG - Intergenic
928706444 2:33954741-33954763 GTACATAGAGAGAAGAAGGACGG + Intergenic
928868026 2:35941687-35941709 GTAATTTGGAAGAAGAAGGCTGG + Intergenic
929182646 2:39060033-39060055 GTGAAAAGGGAGAAAAGGGAAGG + Intronic
930875190 2:56207282-56207304 GTGCATAGGGAAGAGTAGGCAGG + Intronic
931181021 2:59900759-59900781 GGGACTAGGTAGAAGAAGGCAGG + Intergenic
931711702 2:64993451-64993473 GAGAATTGGGATGAGAAGGCTGG + Intronic
932404358 2:71503679-71503701 CTGAATCTGGAGAAGAGGGCTGG - Intronic
933206688 2:79514180-79514202 GAAAATAGGGAGCAGAAGGGTGG + Intronic
934658428 2:96130033-96130055 AAGCAGAGGGAGAAGAAGGCAGG + Intronic
935624722 2:105162627-105162649 TTAAATGGGGAGAAGAAGGGAGG + Intergenic
936479191 2:112869264-112869286 GTGAACTGGGAGACAAAGGCAGG - Intergenic
936705950 2:115073963-115073985 GTAAAGAGTGAGAAGAAGGTTGG + Intronic
937312028 2:120908505-120908527 CTGAAAAGGGAAAAGAAGCCTGG + Intronic
937727426 2:125183900-125183922 CAAAATAGGGAGAAGAAGCCAGG - Intergenic
937934674 2:127233568-127233590 TTGAAAAGGAAGAACAAGGCCGG + Intergenic
938250631 2:129813045-129813067 GTGAATGGGGATAAGGAGTCTGG - Intergenic
938279066 2:130051870-130051892 GAGAATGGGGAGCACAAGGCTGG + Intergenic
938330050 2:130442746-130442768 GAGAATGGGGAGCACAAGGCTGG + Intergenic
938359895 2:130678757-130678779 GAGAATGGGGAGCACAAGGCTGG - Intergenic
938436304 2:131285478-131285500 GAGAATGGGGAGCACAAGGCTGG - Intronic
938450534 2:131414946-131414968 ATGAAAAGGGAAAAGAAGCCAGG - Intergenic
939103605 2:137924544-137924566 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
939941789 2:148360602-148360624 GTGAATAGGGGAAAAAAAGCAGG - Intronic
941125961 2:161583739-161583761 GTGCATAGGGAGAGGAATGTTGG + Intronic
941144307 2:161824475-161824497 GTGAATATGGCGAAAAAGGTGGG + Intronic
941400622 2:165026168-165026190 GTTATTAGGCAGAAGAAGGGTGG + Intergenic
944087856 2:195870108-195870130 GTGCATAAAGAGAGGAAGGCAGG - Intronic
944540814 2:200751894-200751916 GTGACTAGATATAAGAAGGCTGG - Intergenic
945002855 2:205370100-205370122 GTCCAGAGGGAGAAAAAGGCAGG + Intronic
946172994 2:217906306-217906328 GTGGATGGGGAGAAGAAGGATGG - Intronic
946474890 2:219997506-219997528 GTGGAAGGGGAGATGAAGGCTGG + Intergenic
947361008 2:229345415-229345437 GAGAATAGGGAAAATGAGGCAGG - Intergenic
948671563 2:239571784-239571806 GGGAAGAGGGAGAAGAGGCCAGG + Intergenic
1168761731 20:354217-354239 GTGAGGTGGGTGAAGAAGGCTGG + Exonic
1168806184 20:673638-673660 GTGAATAGTGGGAAGCAGGGCGG - Intronic
1168975591 20:1963148-1963170 GTGGATAGAGGGAAGAAGGGAGG + Intergenic
1169068207 20:2706349-2706371 GGGCATAGGGAGATGAGGGCAGG - Intronic
1169219733 20:3815080-3815102 GTGAATAGAAAGTGGAAGGCAGG + Intergenic
1169331520 20:4720327-4720349 GGGAATAGGAAGAAGAGGGGTGG + Intergenic
1170357368 20:15507319-15507341 GGGAATTGGGAGAAGCAGGAAGG - Intronic
1171056307 20:21910255-21910277 GTAAAGAGGAAGATGAAGGCAGG - Intergenic
1171209954 20:23309385-23309407 ATGAAGAGAGAGAGGAAGGCAGG - Intergenic
1171324025 20:24274991-24275013 GGGAATATGGACAAAAAGGCAGG + Intergenic
1171488422 20:25500060-25500082 GGGAATAGGGAGAGGGGGGCAGG + Intronic
1172157004 20:32834020-32834042 GGGAATAGGGGCAAGAAGGTAGG - Intronic
1173727411 20:45307347-45307369 GGGAAAAGGGAGAAGAATCCGGG - Intronic
1173757533 20:45531187-45531209 ATGAAAAGGGAGTAGAAGGAAGG - Intergenic
1174039750 20:47690532-47690554 GTGGATAGGGAGAACAGGGCAGG + Intronic
1174239114 20:49118579-49118601 GTGCATTAGGAGAAGGAGGCAGG - Intronic
1174327162 20:49788648-49788670 GTGGATTGGGAGAAGAAGCTAGG + Intergenic
1174681732 20:52415255-52415277 GTGGACAGGGAGCAGAAGGCAGG - Intergenic
1175301842 20:57948530-57948552 GTGTATACTGAGAAGGAGGCTGG - Intergenic
1175343441 20:58250625-58250647 TTGGACAGTGAGAAGAAGGCAGG + Intergenic
1175407369 20:58743949-58743971 GTGAATAGGGAGTGGATGGGTGG + Intergenic
1175534904 20:59702788-59702810 GTGAAAAGAGAGAAGAAACCAGG + Intronic
1175592755 20:60206602-60206624 GTGATTAGGGGGAAGCTGGCTGG + Intergenic
1175853835 20:62108317-62108339 TTGAAAAGGAAGAAGTAGGCTGG + Intergenic
1176456333 21:6915581-6915603 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1176834507 21:13780641-13780663 AGGAATAGGGAGAAAGAGGCAGG - Intergenic
1177613059 21:23478590-23478612 CTGATTAGGTAGAAGTAGGCTGG + Intergenic
1178084201 21:29096045-29096067 GTTTATAGTGAGAAGTAGGCTGG + Intronic
1179781233 21:43702274-43702296 GAGAATGGGGAAAAGAAGACAGG + Intergenic
1181064237 22:20298292-20298314 GTGCACAGGGAGAAGCAGGTGGG + Intergenic
1182576289 22:31275317-31275339 GTGAGCTGGGAGAAAAAGGCAGG - Intronic
1183286917 22:36972294-36972316 ATGACTAGGGAGATGAAGTCTGG + Intergenic
1184370235 22:44077289-44077311 GTGAAGAGGGAGACAGAGGCTGG - Intronic
1184550110 22:45199968-45199990 AGGGATGGGGAGAAGAAGGCAGG + Exonic
1184854278 22:47137922-47137944 CTGAAGAGGGAGGCGAAGGCAGG - Intronic
1184922129 22:47613222-47613244 GTGAATGAGGAGAAGAGTGCAGG - Intergenic
1185371129 22:50461433-50461455 GAGAAAAGGGAGAGGGAGGCAGG + Intronic
949701258 3:6761807-6761829 ATGAATGTGGAGAAGCAGGCAGG + Intergenic
950838424 3:15942879-15942901 TAGAAGAGAGAGAAGAAGGCAGG - Intergenic
950916009 3:16646118-16646140 GTAAACAGGGAGAAGAGAGCGGG + Intronic
951875207 3:27417246-27417268 ATGAACAGGGAGAACCAGGCAGG + Intronic
952169488 3:30791241-30791263 CTGAAAAGGGAGAAAAAGGATGG - Intronic
952486500 3:33816853-33816875 GAGAATAAGGAGCAGATGGCAGG + Intronic
952609329 3:35188608-35188630 TTGCATAGGGAGCTGAAGGCAGG + Intergenic
953148047 3:40297029-40297051 AAGAACAGGGAGAAAAAGGCAGG - Intergenic
953152626 3:40338921-40338943 CTAAAAAGGGAGAAGAAGCCAGG + Intergenic
953236820 3:41114155-41114177 TGGCATAGGGAGAAGGAGGCTGG + Intergenic
953243804 3:41172766-41172788 GAGAAAAGGAGGAAGAAGGCAGG - Intergenic
953768198 3:45760081-45760103 GTGAATAGGGACAGGCAAGCTGG - Intronic
954008541 3:47613811-47613833 GTGAAGAGGGAGAGGAAGGCAGG - Intronic
955424682 3:58776036-58776058 CAGAAAAGGGAGAGGAAGGCTGG - Intronic
955673960 3:61430703-61430725 ATGAGTAGGCAGAGGAAGGCAGG - Intergenic
955909356 3:63844197-63844219 GTGGCTAGGGAGAAGGAGGTTGG + Intronic
956094745 3:65704071-65704093 GAGAAGAGGGGAAAGAAGGCAGG + Intronic
956681294 3:71784679-71784701 GTGATGAGGGAGAAGTAAGCGGG + Intronic
957215467 3:77315045-77315067 TGGTATAGGGAGAAGAAAGCTGG + Intronic
957961607 3:87261148-87261170 GTGAATTGGGAGGCCAAGGCGGG - Intronic
959201178 3:103249759-103249781 GTGATTAGGGTGGAGAAGGGTGG - Intergenic
959360630 3:105386515-105386537 GGGAATAGGGATAGGAAGGTAGG - Intronic
959403164 3:105928138-105928160 GTGAATATGGAGAGGAATGGTGG - Intergenic
960357462 3:116671094-116671116 GGGAAGAGGGAGGAGGAGGCAGG + Intronic
960393078 3:117103345-117103367 GTAATGAGGGAGAACAAGGCAGG + Intronic
960639098 3:119810032-119810054 GAGAATGGGGAGCAGAAGGGGGG - Intronic
960812264 3:121636352-121636374 GAGAAGAGCGTGAAGAAGGCTGG - Intronic
960997773 3:123351082-123351104 GTGAATGGGGAGAGCCAGGCTGG + Intronic
961223616 3:125219534-125219556 GTGACTCGGGAGATGCAGGCCGG + Intergenic
962203069 3:133415822-133415844 GTGAGTAGAGGGAAGAGGGCAGG - Intronic
962203127 3:133416068-133416090 GTGAGTAGAGGGAAGATGGCAGG - Intronic
962203560 3:133417819-133417841 GTGAGTAGAGAGGAGAGGGCAGG - Intronic
964777825 3:160298042-160298064 GTGAATAGGGAGAAGAAGGCAGG + Intronic
966413034 3:179662847-179662869 GTCCATAGGGAGAGGAATGCAGG - Intronic
967119125 3:186367033-186367055 GTGAGTAGGGAGAAAAAAGGAGG + Intergenic
967202501 3:187084890-187084912 GGGAATAGGGAGGAGCAGGGAGG - Intergenic
967310194 3:188098750-188098772 GTGATTAGGAATAAGAAGGTTGG + Intergenic
967570261 3:191019890-191019912 TTGAATAGTGCGAAGAAGGGAGG - Intergenic
967664799 3:192158294-192158316 GAGAAAAGGGAAAAGCAGGCAGG - Intronic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968076195 3:195817125-195817147 CTGCATAAGGAGAAGGAGGCCGG - Intergenic
968268749 3:197383189-197383211 GTCAAAAGGGAACAGAAGGCCGG - Intergenic
969666751 4:8561905-8561927 TTTAAAAGGGAGAAGCAGGCTGG + Intronic
970348837 4:15180624-15180646 GAGAACAGGGTGAGGAAGGCTGG + Intergenic
970760466 4:19480259-19480281 GTTAATAGGCAGAAGGAGGGAGG - Intergenic
970990972 4:22212700-22212722 GGGAAGAGGGAGAAAAAGGTAGG + Intergenic
971136615 4:23875638-23875660 GTGATAAAAGAGAAGAAGGCTGG - Intronic
971232294 4:24809477-24809499 GTGAGTAGGGAAATGAGGGCTGG - Intronic
971849673 4:31968086-31968108 GAGAAGAGAGAGAAGAGGGCTGG - Intergenic
971922007 4:32952761-32952783 GGGAATAGAGAGAAGAAAACAGG + Intergenic
972589531 4:40471326-40471348 GTGGATAGGGAGAAGCCAGCTGG - Intronic
973605952 4:52588043-52588065 ATGAAAAGAGAGAAGAAGACGGG - Intergenic
975302857 4:72811687-72811709 GAGAAAAGGGAGAAAAAGACTGG + Intergenic
975644067 4:76528848-76528870 AAGAATAGGGAGAGGAAGACCGG - Intronic
977009468 4:91618551-91618573 GAGAAAAGGGAGAAGAAGAGTGG + Intergenic
977015117 4:91682823-91682845 GTGAATATGGAAACGAAGGTTGG - Intergenic
978609960 4:110526564-110526586 GTGAAGACGAAGAGGAAGGCAGG + Intronic
978886260 4:113769770-113769792 GGGAAGTGGGGGAAGAAGGCGGG - Intergenic
980563031 4:134502047-134502069 GGGAAAAGGGGGAGGAAGGCAGG - Intergenic
981676699 4:147350904-147350926 GGGAAGAGGGATAAGAAGGAAGG + Intergenic
982076897 4:151746800-151746822 GGGAACAGGGAGATGGAGGCAGG + Intronic
984290658 4:177789747-177789769 GAGAAAAGGGAGAATAAGGAGGG + Intronic
985099119 4:186440413-186440435 GTTGAAAGGGAGAGGAAGGCTGG + Intronic
986037606 5:3955058-3955080 AAGAATAGGAAGAAGAAGGAAGG - Intergenic
987090958 5:14507359-14507381 GTGACTAGGGACAAAAAGGGTGG + Intronic
987206802 5:15635677-15635699 ATGAAGATGGAGAAGTAGGCAGG + Intronic
987486144 5:18529803-18529825 GTCAATGGGGTGAAGAAGCCAGG - Intergenic
987492171 5:18595030-18595052 TTGAAGACTGAGAAGAAGGCAGG - Intergenic
987976588 5:25022484-25022506 AGAAATAGGGAGAGGAAGGCTGG + Intergenic
988602210 5:32650246-32650268 GTGAATAAGGCAAAGTAGGCAGG - Intergenic
988789586 5:34594940-34594962 GGGCATAGGGAGAAGAATTCAGG - Intergenic
990224521 5:53634605-53634627 GGGAAGAGGGAGAGGAAGGAGGG - Intronic
990252767 5:53933348-53933370 GTAAAGATGGAGAAAAAGGCCGG + Intronic
991187598 5:63828389-63828411 GTGAAAAGGGAGAAGACAGAGGG + Intergenic
991432935 5:66567295-66567317 GTGAATTGGAAGAAAAAGACTGG + Intergenic
991777327 5:70097860-70097882 GTGAGTTGTGAGAAGAAGACTGG - Intergenic
991856615 5:70973304-70973326 GTGAGTTGTGAGAAGAAGACTGG - Intronic
992230588 5:74659587-74659609 GTGAATATGGAGAAAAAGTGGGG + Intronic
992612972 5:78523435-78523457 GTGAGGGGGTAGAAGAAGGCGGG + Intronic
992888391 5:81181800-81181822 GTGAATAGGGGAACCAAGGCTGG - Intronic
992901193 5:81298703-81298725 GTGAATCTGGAAAGGAAGGCTGG - Intergenic
992998175 5:82353012-82353034 ATGAATAGGAAGAATAGGGCAGG + Intronic
993074894 5:83217105-83217127 GTGCATTGGGAGGACAAGGCGGG + Intronic
993866790 5:93205423-93205445 ATGAATGGGGAGAGGAAAGCTGG + Intergenic
995845804 5:116492565-116492587 GAGAATAGGAGGAAAAAGGCAGG + Intronic
995919622 5:117295789-117295811 GTGAATAGGGAGGAGGGGTCAGG - Intergenic
996205866 5:120734284-120734306 GGGAAGAGGGAGCAGGAGGCTGG + Intergenic
997029246 5:130104570-130104592 GTAAACAGAGAGAAGAAGGAAGG + Intronic
997361045 5:133295116-133295138 CTGAGGAGGGAGAAGAAGGTCGG - Intronic
998037771 5:138931301-138931323 GGGAATAGGGGGATGAAGACGGG - Intronic
998400887 5:141848631-141848653 GAGAAGTTGGAGAAGAAGGCAGG - Intergenic
998569626 5:143245599-143245621 GAGAAAGGGGATAAGAAGGCAGG - Intergenic
998592219 5:143489801-143489823 GTGAGTGGGGAGAGGAAGGGAGG + Intergenic
1000022762 5:157333006-157333028 GTGAAAAGGGAAAAAAAGGAGGG + Intronic
1000111943 5:158116546-158116568 GTGGATAGGGATGAGAATGCAGG + Intergenic
1000496610 5:161991953-161991975 CTGAATAGGGAGAAATAGTCAGG - Intergenic
1004294263 6:14395710-14395732 GTGGGTAGGGAGGAGAAGGCTGG - Intergenic
1004358255 6:14948705-14948727 GTGAGTAGGCAGAATAAGACCGG - Intergenic
1004830325 6:19470233-19470255 GTGAATGGGCAGGAGTAGGCAGG - Intergenic
1005991908 6:30908465-30908487 GCGAAGAGTGAGAGGAAGGCAGG + Intronic
1006299604 6:33186521-33186543 GGGAATAGGGAGATGAGGGTGGG + Intronic
1006641198 6:35490713-35490735 GGATCTAGGGAGAAGAAGGCGGG - Intronic
1006967299 6:38001050-38001072 GAGAATAGGTTGAAGAATGCAGG + Intronic
1007240752 6:40423332-40423354 GGGAATAGGGACTAGAAGACAGG + Intronic
1007313904 6:40968996-40969018 GTGAACAGGGAGAAGAGCCCAGG - Intergenic
1007550316 6:42724439-42724461 ATGAATAGGCAGAACATGGCAGG - Intergenic
1007935798 6:45730767-45730789 GTGAAGAGGAAGAAGAAAGGGGG - Intergenic
1010017352 6:71120971-71120993 CTTAAGAGAGAGAAGAAGGCCGG - Intergenic
1010158183 6:72820029-72820051 GTGAAGAGGGAGAAAAATGGAGG - Intronic
1010386368 6:75284866-75284888 GGGAGGAGGGAGAAGAAGGAGGG + Exonic
1011203796 6:84869178-84869200 GTGACAAAGGAGAAGAAGGCAGG - Intergenic
1011218649 6:85031854-85031876 GAGAAGAGAGAGAAGAGGGCAGG + Intergenic
1011675446 6:89728717-89728739 GTGATTAGGGAGACTGAGGCAGG + Intronic
1011959111 6:93064945-93064967 GAGAATATGGAGAAGAATGTGGG - Intergenic
1012716406 6:102678285-102678307 ATGAATAGGGAGAAGATGGAGGG - Intergenic
1013724742 6:113080137-113080159 GGGAAGAGAGAGAAGAAGGAAGG + Intergenic
1013797746 6:113905616-113905638 GTGAATAGTGAGAACAGGGGAGG - Intergenic
1014327183 6:120013089-120013111 GGGCATAGGGAGTAGAAGGATGG - Intergenic
1015156533 6:130102593-130102615 ATGAACCGGGAGAAGCAGGCAGG - Intronic
1016471411 6:144378549-144378571 GAGAACAGGGTGAAGGAGGCAGG + Intronic
1016734705 6:147464707-147464729 AAGAATAGGGAGAGGAAGGAAGG - Intergenic
1016938390 6:149465456-149465478 GTCAAAAGGAAGAGGAAGGCCGG + Intronic
1016958981 6:149653547-149653569 GAGAACAAGGAAAAGAAGGCTGG + Intergenic
1017129287 6:151094164-151094186 GTCAGTGGGGAGAAGGAGGCGGG - Intronic
1017677951 6:156834136-156834158 ATGAATGGGGAGAGGAAGACTGG + Intronic
1017834735 6:158167424-158167446 GTTACTAGGGAGAATGAGGCAGG + Intronic
1018438811 6:163789152-163789174 TTGACTGGGGAGAAGAGGGCAGG - Intergenic
1018772909 6:166987640-166987662 GTCAAAAGGGAAAAGAAGGCTGG + Intergenic
1018844733 6:167547598-167547620 GGGAAGAGGGAGGAGAAGGGAGG - Intergenic
1021199057 7:17706969-17706991 GTGGGCAAGGAGAAGAAGGCTGG + Intergenic
1021225405 7:18020629-18020651 ATGAATAGGCAAAAGAAGGTTGG - Intergenic
1022280180 7:28900411-28900433 GTGAATAGGGAGACAAAGAGTGG - Intergenic
1022395772 7:29987144-29987166 GTGCAGAGGGAGAAGGTGGCAGG - Intronic
1023032041 7:36098352-36098374 AGGAATAGGAAGATGAAGGCAGG + Intergenic
1024589503 7:50868762-50868784 ATGTATAGGGAGAAGAGGGGTGG + Intergenic
1024771074 7:52723938-52723960 GTTAAAAGGAAAAAGAAGGCCGG - Intergenic
1025198712 7:56949441-56949463 AGGAATAGGGAGAAGGAGGAGGG - Intergenic
1025673236 7:63627490-63627512 AGGAATAGGGAGAAGGAGGAGGG + Intergenic
1026336551 7:69398748-69398770 GAGAAAAGGGAGAATAAGGAAGG + Intergenic
1026890584 7:73979429-73979451 GTCAAGAGGCAGAAGCAGGCAGG + Intergenic
1027602847 7:80260508-80260530 GTGAATAGGAAGAAGGAGTGTGG + Intergenic
1027744748 7:82059048-82059070 GAGACTAGAAAGAAGAAGGCAGG - Intronic
1028136020 7:87223748-87223770 GGGAAGAGGGAGGAGAAGGATGG - Intergenic
1028279837 7:88909427-88909449 CTGAAAAGGCAGAAGATGGCAGG + Intronic
1028951713 7:96643907-96643929 GTTAATAAGGAGAAGAAAGTGGG - Intronic
1031009508 7:116511275-116511297 GTGAATAGGGAGAAGAAATTGGG - Intergenic
1031084210 7:117286422-117286444 GAGAATAGGGAGAGAAGGGCGGG - Intronic
1032114049 7:129101950-129101972 GGGAATAGCGAGAGGAAGGCAGG + Intergenic
1034702422 7:153108216-153108238 GTGACTACTGAGAAGAAGGTAGG - Intergenic
1035043558 7:155948670-155948692 GTCAAGAGGGAGGAGTAGGCTGG + Intergenic
1036290403 8:7483245-7483267 GTGAATATGGAGGAGAAATCAGG - Intronic
1036331083 8:7828290-7828312 GTGAATATGGAGGAGAAATCAGG + Intronic
1036659438 8:10698464-10698486 GTGACCAGGGAGACAAAGGCTGG + Intronic
1036916644 8:12810722-12810744 GAGCAAAGGGAGAAGAAGGAAGG - Intergenic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037622412 8:20576405-20576427 GAGACTATGGAGAAGTAGGCAGG + Intergenic
1038093108 8:24276569-24276591 GTGAATATGGAGAAGTAGCTTGG - Intergenic
1038905660 8:31899349-31899371 GAGAATAGGGAATAGAAGGATGG - Intronic
1039447465 8:37644070-37644092 GTGAAGGGTGAGCAGAAGGCAGG + Intergenic
1040499184 8:47992279-47992301 GTGATTTGGGAAATGAAGGCAGG + Intergenic
1040568641 8:48589120-48589142 GCCAAGAGGGAGAAGAAGGGTGG - Intergenic
1040933821 8:52763254-52763276 GTAAAAAGGGAGATCAAGGCAGG - Intergenic
1041155795 8:54985481-54985503 GAGAAGAGGGAGAAGGAGGGAGG + Intergenic
1041241876 8:55855159-55855181 GAGAAGGGGGAGAAGAAGGAAGG - Intergenic
1041314186 8:56544555-56544577 GTGATTAGGGAAGGGAAGGCTGG - Intergenic
1041333794 8:56757347-56757369 GGGAAGAGGGAGATGAAGGTAGG + Intergenic
1041606502 8:59788190-59788212 GAGAATTGGGAGATGGAGGCAGG - Intergenic
1041647580 8:60269205-60269227 GTAAAAAGGGAGAATAATGCTGG - Intronic
1043084454 8:75810918-75810940 ATGAAGAGGAAGAAGAAGGAAGG - Intergenic
1043795609 8:84534706-84534728 GAGAACAGGGAGAAGAAGGAAGG + Intronic
1044352279 8:91180690-91180712 GAAAATAGGAAGATGAAGGCAGG + Intronic
1044762064 8:95530479-95530501 GTGGATAGGGCGAGAAAGGCAGG - Intergenic
1046730736 8:117723273-117723295 GTGAATAGGATGAAGGAGGGAGG - Intergenic
1048457055 8:134587737-134587759 GGGAATGGAGAGAAGAAGGTAGG - Intronic
1049101253 8:140580522-140580544 GTGGAAAGGGAGACGAAGGTGGG - Intronic
1051173646 9:14343683-14343705 GGGAAAAGGAAGAAAAAGGCTGG + Intronic
1051351862 9:16204898-16204920 ATGCATAGGGAGGAGAAGGATGG + Intronic
1052994524 9:34544124-34544146 CAGAAGAGGGAGAGGAAGGCAGG + Intergenic
1053250059 9:36566891-36566913 GTGGAACGGGAGAAAAAGGCTGG - Intergenic
1053477942 9:38395692-38395714 GTGAACAGGTGGGAGAAGGCAGG - Intronic
1054903601 9:70394601-70394623 GTAAATGGTGAGAAGAAGGGGGG + Intronic
1057352209 9:94308460-94308482 GTGAAAAGAATGAAGAAGGCTGG + Intergenic
1057655433 9:96947630-96947652 GTGAAAAGAATGAAGAAGGCTGG - Intronic
1058164848 9:101607550-101607572 GTGAGCAGGGAGAAGGAGGAGGG + Intronic
1058947770 9:109875072-109875094 CTGAAGATGGAGAAGAAGGCAGG - Intronic
1059842052 9:118228616-118228638 CTGAAGAGGGAGAAGAAGTTTGG + Intergenic
1059933160 9:119281471-119281493 GGGATCAGGGAGAAGAAGGGAGG + Intronic
1060734686 9:126059441-126059463 TTAAATAGGGATAATAAGGCCGG + Intergenic
1060857523 9:126926791-126926813 GTGGATGGGGAGGAGAAGGCAGG + Intronic
1060874274 9:127069055-127069077 GTGCATATGAAGAAGGAGGCAGG - Intronic
1061637119 9:131919102-131919124 GGGAGTAGGGAGAAGGAGGATGG + Intronic
1061875703 9:133542561-133542583 GTGAATATGGAGAAGAATGAGGG - Intronic
1062437998 9:136555345-136555367 GGGACTAGGACGAAGAAGGCTGG - Intergenic
1185699838 X:2222629-2222651 GTGCTTTGGGAGAACAAGGCAGG + Intronic
1186815005 X:13227647-13227669 GTGAAGAGGGAGAAAATGCCAGG - Intergenic
1188829245 X:34876228-34876250 GAGAATATGGAGAAGAATCCAGG + Intergenic
1190111321 X:47590792-47590814 GGGAATAGGAAGAAGAAGTAGGG - Intronic
1190443521 X:50499509-50499531 GTGCATAGGGAGAGGAAGAGGGG + Intergenic
1191131603 X:57018704-57018726 ATGAATAGAGAGAAGAAAACGGG + Intergenic
1191937726 X:66443033-66443055 GGGAATGGGGAGAAGAGGGGAGG - Intergenic
1193055821 X:77148901-77148923 TTTAAAAGGGGGAAGAAGGCAGG + Intergenic
1193254557 X:79331852-79331874 GAGAATAGGGAAAATGAGGCAGG - Intergenic
1197286264 X:124598705-124598727 GTGGACAGGGAGTAGAAGGATGG + Intronic
1197611331 X:128642355-128642377 GAGGATAGGGAGTAGAAAGCAGG + Intergenic
1197764301 X:130049953-130049975 CTTAAAAGGGAGAAGCAGGCTGG + Intronic
1198750240 X:139931880-139931902 GTGAAAAGGAAGAAGAGGGGTGG + Intronic
1199882534 X:151986022-151986044 GAGCAAAGGGAGGAGAAGGCTGG - Intergenic
1200074109 X:153542834-153542856 GTGAAACGGGACAGGAAGGCTGG + Intronic
1200576670 Y:4896447-4896469 GTGTAGAGTGAGAAGAAGGAGGG - Intergenic