ID: 964785104

View in Genome Browser
Species Human (GRCh38)
Location 3:160387705-160387727
Sequence CAGTAAGTCTGGAGTCAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 1, 2: 1, 3: 10, 4: 188}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964785100_964785104 13 Left 964785100 3:160387669-160387691 CCCAATGGAGAAGTCAAAGAGAA 0: 1
1: 1
2: 4
3: 45
4: 473
Right 964785104 3:160387705-160387727 CAGTAAGTCTGGAGTCAAGTGGG 0: 1
1: 1
2: 1
3: 10
4: 188
964785101_964785104 12 Left 964785101 3:160387670-160387692 CCAATGGAGAAGTCAAAGAGAAA 0: 1
1: 0
2: 3
3: 56
4: 410
Right 964785104 3:160387705-160387727 CAGTAAGTCTGGAGTCAAGTGGG 0: 1
1: 1
2: 1
3: 10
4: 188

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964785104 Original CRISPR CAGTAAGTCTGGAGTCAAGT GGG Intronic
903518063 1:23925918-23925940 CAGGAATTCTGGAGTGAGGTGGG - Intergenic
905297849 1:36965643-36965665 CAGCAAGTCTGGAGGCCTGTGGG - Intronic
905937514 1:41836607-41836629 CAGTAAGTTTGGAGTAGTGTGGG - Intronic
907600286 1:55761912-55761934 CAGGGAGAATGGAGTCAAGTTGG + Intergenic
908901964 1:68965807-68965829 CAGGAATTCTGGGGTTAAGTGGG + Intergenic
910700763 1:90071764-90071786 CAGAAAGTGTGAAGTCAAGGGGG + Intergenic
913658511 1:120984680-120984702 CAGTAAGAGTGGAGTCAAACAGG - Intergenic
914009878 1:143767789-143767811 CAGTAAGAGTGGAGTCAAACAGG - Intergenic
914254960 1:145954409-145954431 CTGTAAGACTGGAGTTAAATGGG - Intronic
914523122 1:148435919-148435941 CAGTAAGACTGGAGTCAAACAGG - Intergenic
914648498 1:149676450-149676472 CAGTAAGAGTGGAGTCAAACAGG - Intergenic
916690291 1:167183754-167183776 CAGGAAGTCAAGAGTCAAGGAGG + Intergenic
917218441 1:172702265-172702287 CAGTTTGTCTGGAGTGGAGTGGG + Intergenic
918499497 1:185178270-185178292 CAGTATGACTAGAGTCAAGATGG + Intronic
918883969 1:190166762-190166784 CACTCAGGCTGGAGTCCAGTGGG + Intronic
920869963 1:209785797-209785819 CAGCAAGTTTGCAGTCAAGCAGG + Exonic
921304570 1:213782883-213782905 CAGACAGGCTGGAGTGAAGTTGG + Intergenic
924258603 1:242207105-242207127 CAGTAGGTTTTGAGTAAAGTAGG - Intronic
1063197464 10:3756925-3756947 GAAAAATTCTGGAGTCAAGTTGG + Intergenic
1064316067 10:14257829-14257851 CTGGAAGTCTGAAATCAAGTTGG - Intronic
1066437875 10:35410813-35410835 CAGTAAGTCTGGAGTAGGGTGGG + Intronic
1066755604 10:38709190-38709212 CAGTAAGTTAGGAGTCAATGAGG + Intergenic
1068027336 10:51662881-51662903 CAGTAAGTGTGGAGTGTATTGGG + Intronic
1068095600 10:52487397-52487419 CAATAGGTCTGGAGTAAGGTTGG + Intergenic
1073499130 10:103919961-103919983 CAGTAAGCATGGAGTCCAGGAGG - Intergenic
1079422307 11:20305014-20305036 CAGAAAGTCTGCAGTCAGGATGG + Intergenic
1079587896 11:22148934-22148956 CAGGAAGAATGGAGCCAAGTTGG - Intergenic
1080774953 11:35377232-35377254 CAGCAAGTCAGCAGTAAAGTTGG + Intronic
1082806302 11:57453797-57453819 CAGCAAGTTCAGAGTCAAGTGGG + Intergenic
1083594234 11:63911448-63911470 CAATAAGTCTGGGGTGAGGTGGG - Exonic
1086146590 11:83559226-83559248 CAGAATCTCTGGAGTCTAGTGGG + Intronic
1088212640 11:107473557-107473579 CAGTGAGGCTGGAATAAAGTAGG - Intergenic
1088241169 11:107775150-107775172 CACTCAGGCTGGAGTGAAGTGGG - Intergenic
1090909600 11:131106840-131106862 CAGAAAGTCTGCAGTAAAGGGGG - Intergenic
1097933503 12:65217856-65217878 CACTCAGGCTGGAGTGAAGTAGG + Intronic
1098014803 12:66092846-66092868 CAGTGGGTCTGGAGCCAAGCAGG - Intergenic
1099778582 12:87165570-87165592 AAGCAAGTCTGAAATCAAGTAGG + Intergenic
1102763326 12:115408624-115408646 CACTATGTCTAGAGTCAAGCGGG + Intergenic
1102853121 12:116269614-116269636 CACTAAGGCTGGAGTGCAGTGGG - Intronic
1103657808 12:122487482-122487504 CAGTATTACTGGAGTCAAATAGG - Intronic
1104332149 12:127856916-127856938 CAGAAAGTCTGGAGTCAAGAGGG + Intergenic
1104791306 12:131483750-131483772 CAGTAAGTCTGGAGACAAGTGGG + Intergenic
1106234536 13:27850960-27850982 CAGTAGGTCTGGGTTAAAGTGGG - Intergenic
1106644353 13:31616599-31616621 CAGGCAGGCTGGAGTAAAGTGGG - Intergenic
1106949900 13:34871806-34871828 CTGTAAGTCTGGAGCCAAGGGGG - Intergenic
1111416568 13:87954507-87954529 CAATAAGTCTGGCATCAACTGGG - Intergenic
1112038042 13:95515820-95515842 CTGTCAGTTTGGAGCCAAGTAGG - Intronic
1112355662 13:98673028-98673050 CAGTCTGTCTGGACTCAGGTAGG - Intergenic
1112608460 13:100931249-100931271 CAGTCAGTCTAGAGTCAACGTGG + Intergenic
1113206981 13:107928281-107928303 TAGTAAGTTTGAAGTCAGGTAGG + Intergenic
1113429990 13:110241322-110241344 CAGCAGGGCTGGAGCCAAGTTGG - Intronic
1115336440 14:32247737-32247759 CAGTCAGTCTGGACTCTGGTGGG + Intergenic
1116651396 14:47597347-47597369 CAGTAAAACTGAAGTCAATTGGG + Intronic
1116917320 14:50537734-50537756 CTGCAAGTCTGAAATCAAGTGGG - Intronic
1117636443 14:57749456-57749478 CAGTATGTATTGAGTCATGTGGG - Intronic
1119951999 14:78754706-78754728 CAGTAGGTCTAGAGTGGAGTGGG - Intronic
1121244297 14:92451175-92451197 CAGAAAGTGTGGAGGGAAGTGGG + Intronic
1123129339 14:105973066-105973088 CAGGAACTCTGGATTCAAGGTGG - Intergenic
1123519184 15:21055940-21055962 CAGGAACTCTGGATTCAAGGTGG - Intergenic
1124893690 15:33756768-33756790 CAGTATGTCTGGGGTCAATAAGG + Intronic
1124907149 15:33880512-33880534 CTGTAAGTTAGGAGTAAAGTAGG + Intronic
1127693921 15:61425341-61425363 CAGTAAGACTGGGGTATAGTAGG - Intergenic
1128866652 15:71119619-71119641 CAGTGAGTCTGGTGGCAGGTGGG - Intronic
1133687807 16:8182827-8182849 CAGTGAGTCTGAAGTGAAGCGGG + Intergenic
1137505510 16:49050866-49050888 CAGTAGGTCTGGAGGGATGTGGG - Intergenic
1138392340 16:56679251-56679273 CAGCCAGTCAGGAGTGAAGTGGG - Intronic
1138872168 16:60903979-60904001 CAGTAAGTTTGGGGTCCACTGGG - Intergenic
1139684365 16:68591147-68591169 CGGCCAGTCTGGAGTGAAGTGGG - Intergenic
1141143589 16:81513753-81513775 CACTAAGTCTGGAGCCAGCTAGG - Intronic
1142882375 17:2891753-2891775 CAGCAACTCTGGAATCTAGTAGG - Intronic
1143031551 17:3970757-3970779 AAGTAAGTCTGGAGACAGGAAGG - Intergenic
1146553266 17:33800366-33800388 CAGAAACTCTGGAGTCATATAGG - Intronic
1148151814 17:45401376-45401398 GAGTAGGTCTGGAGTCTTGTGGG - Intronic
1149168964 17:53786796-53786818 CAGGCAGTCTGGTGTCTAGTGGG - Intergenic
1149222611 17:54433045-54433067 AAGAAAGTCTGGTGTCATGTTGG - Intergenic
1150001833 17:61445164-61445186 CAGTAGGTCTGTGGCCAAGTAGG + Intergenic
1150526599 17:65929780-65929802 CAGCAAGTCTTGAACCAAGTTGG - Intronic
1152884629 17:82842337-82842359 CAGTAAGGCTGGAATCGAGGAGG - Intronic
1153375168 18:4368955-4368977 CAGTAACTGTGGAGCAAAGTAGG + Intronic
1157573065 18:48725586-48725608 CAGTAAATCTGGGGTCAAAAGGG - Intronic
1158677147 18:59530232-59530254 GAGGAAGTCTGGAGTCAAGGTGG + Intronic
1160298896 18:77660986-77661008 CACTAAGCCTGGAGTGCAGTGGG - Intergenic
1160727786 19:625186-625208 CAGCAGGTCCGGAGTCAAGCCGG + Exonic
1163723451 19:18909341-18909363 CCGTAAGTCTGAAGTCAAGGTGG + Intronic
1163732563 19:18958123-18958145 CAGTAAGTTTGGTGTCAATATGG - Intergenic
1165608303 19:37126606-37126628 CAGTTAGTCTGGTGTAATGTTGG + Intronic
1165712134 19:38019377-38019399 TAGTGAGTCTGGAGTCCAGGTGG + Intronic
1165921906 19:39304296-39304318 CAGTGTGTCTGGACTGAAGTGGG - Intergenic
1166066366 19:40361566-40361588 CAGTGTGTCTGCAGTGAAGTGGG - Intronic
1166878263 19:45911481-45911503 CAGGGAGTCTGGACTGAAGTAGG - Intergenic
1168723873 19:58570257-58570279 CAGTCAGTCTGAAGTCCACTGGG - Intronic
925308278 2:2865299-2865321 CTGTCTGTCTGGAGTCATGTGGG + Intergenic
929279918 2:40066538-40066560 CAAGAAGTGTGGAGTGAAGTGGG + Intergenic
933187894 2:79299136-79299158 CAGCAAGTCAGGAGTGGAGTAGG + Intronic
933760258 2:85667683-85667705 CAGGAAGTCTGGGGACATGTGGG - Exonic
933789618 2:85873323-85873345 CAGCAAATCAGGAGTCAAGTTGG + Intronic
936611082 2:114002630-114002652 CAATAGGTCTGGAGTGTAGTTGG + Intergenic
936981139 2:118266499-118266521 CAGGAAATCTTGGGTCAAGTAGG - Intergenic
937571267 2:123365144-123365166 CAGTAAGTCTGCAGGCTATTTGG - Intergenic
937757035 2:125552205-125552227 TAGGACGTCTGGAGTCCAGTTGG - Intergenic
940477102 2:154176988-154177010 CAGTAAGTTTGGAGTGGAGAGGG - Intronic
941656253 2:168147925-168147947 AAGTAAGTCTGGATTGCAGTTGG - Intronic
944371565 2:198989722-198989744 CATTCATTCTGGATTCAAGTTGG - Intergenic
944863497 2:203838383-203838405 CAGTAAGTCAAGAGTGCAGTTGG - Intergenic
947888503 2:233595333-233595355 CAGAAAGTTTGTAGTCAAGCAGG + Intergenic
948667396 2:239545292-239545314 CAGTGGGTCTGGTGTCACGTGGG + Intergenic
948752578 2:240141087-240141109 CAGAAAGTGTGGGGTCAAGATGG + Intronic
948966915 2:241389450-241389472 CTGGAAGTCTGCAGTCAAGCTGG - Intronic
1171969869 20:31557566-31557588 CAGTTATTCTGGAATCAAGCTGG - Intronic
1173284401 20:41657105-41657127 TAGAAAGACTGCAGTCAAGTAGG - Intergenic
1173359563 20:42330078-42330100 TAGCACTTCTGGAGTCAAGTAGG - Intronic
1175177455 20:57120762-57120784 ACGGAAGTCTGGAGTCAAGATGG - Intergenic
1179040065 21:37795027-37795049 CAGTAAGGCTGGTATGAAGTAGG + Intronic
1180951744 22:19723578-19723600 CGGTGAGTCTGGAGTCCGGTCGG + Exonic
1181479672 22:23190493-23190515 CAGTAAGACTGGATTAAGGTGGG + Intronic
1182029709 22:27148280-27148302 AAGTCAGTCTGGATTCAAATAGG + Intergenic
1182803880 22:33054233-33054255 CTGTGAGTCTGGAGTCGAGGAGG - Intronic
1183790734 22:40066803-40066825 CAGTAAGTTTATAATCAAGTTGG - Intronic
952213971 3:31257129-31257151 CATTAAGACTGGAGTCCAGAAGG - Intergenic
952974712 3:38683821-38683843 CAGAAGGCCTGGAGTCAAATTGG + Intergenic
953000905 3:38932227-38932249 CAGTCAGGCTGGAGCCAAGATGG + Intronic
953735785 3:45493035-45493057 CAGTAATTCTGCAGCCAAGCAGG - Intronic
955390894 3:58521508-58521530 CAGAAGGCCTGGAGACAAGTGGG - Intronic
957150852 3:76484448-76484470 CAGTGAGTCCACAGTCAAGTGGG + Intronic
963869258 3:150396959-150396981 CAGTAATTCTCCAGCCAAGTAGG - Intergenic
964187042 3:153958682-153958704 CAGTCAGACTGGAGTGCAGTGGG + Intergenic
964785104 3:160387705-160387727 CAGTAAGTCTGGAGTCAAGTGGG + Intronic
973204518 4:47545223-47545245 CAGTGAGTCTGGATTTTAGTGGG + Intronic
978048671 4:104167489-104167511 CACTCAGGCTGGAGTGAAGTGGG - Intergenic
978745179 4:112185396-112185418 CAGTAAGTCAGGGGTGAAGTTGG - Intronic
979228910 4:118323938-118323960 CACTAAGGCTGGATTCCAGTGGG + Intronic
979383977 4:120042131-120042153 CAGTACCTCTGGAGTGCAGTCGG - Intergenic
981638109 4:146903658-146903680 CAATAATTCTGAAGACAAGTGGG - Exonic
981815086 4:148821480-148821502 CAGTAGGTTTTGAGTAAAGTAGG + Intergenic
981885497 4:149667970-149667992 CAGGAAGAATGGAATCAAGTTGG + Intergenic
985004858 4:185524090-185524112 CAGTAGGACTGGAGGGAAGTAGG - Intronic
985164778 4:187081859-187081881 CAATGTGCCTGGAGTCAAGTAGG - Intergenic
986470779 5:8072188-8072210 AAGTTATTCTGGAGTCACGTAGG + Intergenic
987220600 5:15787124-15787146 CCGGAAGTCTGGAGTCAAGGTGG - Intronic
987758740 5:22131401-22131423 CAGCAACTATGGAGCCAAGTTGG - Intronic
988936993 5:36093952-36093974 CAGTAAGTCTTAAATCAACTTGG - Intergenic
989099487 5:37810914-37810936 CCGTGAGTGTGGAGTGAAGTAGG - Intergenic
990358177 5:54991034-54991056 CAGTAATTCTTTAGTCATGTAGG - Intronic
991893443 5:71364840-71364862 CAGCAACTATGGAGCCAAGTTGG - Intergenic
992089624 5:73305354-73305376 ACTTAAGTCTGGATTCAAGTTGG + Intergenic
992519857 5:77539436-77539458 CAGTAGGTCTGGGGTGGAGTGGG + Intronic
992891208 5:81206089-81206111 CAGGAAAACTGGAGTCCAGTAGG - Intronic
993255842 5:85588839-85588861 AAGTTAGTCTGGAGACAAGAAGG + Intergenic
994559978 5:101356270-101356292 CAATACCTCTGGATTCAAGTGGG - Intergenic
996138119 5:119870188-119870210 CAATAAGTCTGGAGTGGAATTGG - Intergenic
997695468 5:135857701-135857723 CTGTCAGGCTGGAGTCAAGGAGG + Intronic
1004813864 6:19291189-19291211 CAGTTAGCCTGTGGTCAAGTTGG - Intergenic
1006877680 6:37312945-37312967 CAGCATGTCTTGAGACAAGTTGG - Exonic
1008332556 6:50261297-50261319 CAGTGAGTTTGGATTCAAGATGG - Intergenic
1011577188 6:88815479-88815501 CAGCAAGTCTGAAGTAAAGGAGG + Intronic
1012669874 6:102030854-102030876 CATTAAGTCTGGAGTTCAGAGGG - Intronic
1013501954 6:110760998-110761020 CAGTAAGGCTGGTTTCAAGTAGG + Intronic
1014089862 6:117391502-117391524 CAGTAAGTCTGAACTCAATGAGG + Intronic
1015489031 6:133804583-133804605 CAGGAAGTCTGAAGTCAGGTTGG + Intergenic
1015563374 6:134540322-134540344 CAGTGAGTCTGGAGCCTAGAAGG + Intergenic
1015911308 6:138169981-138170003 CTGCAAGACTGGAGACAAGTTGG + Intronic
1016276925 6:142364759-142364781 CAGTACTTCTGGAGCCAAGGTGG + Intronic
1018339062 6:162830352-162830374 CAGTATGGCTGGAGCCATGTGGG - Intronic
1020147932 7:5659461-5659483 CAGTATGGCTGGAGCCCAGTGGG + Intronic
1023103305 7:36740265-36740287 CTGCAAGGCTGGAGTCCAGTTGG + Intergenic
1027517487 7:79160853-79160875 CAGTAAGTCTGGGGCTAAGGGGG + Intronic
1027991061 7:85361296-85361318 ATGTAAGTCTGAAGTCCAGTGGG - Intergenic
1031820789 7:126498575-126498597 CAGTAAGTCTCCAGAAAAGTGGG + Intronic
1033656274 7:143376742-143376764 CAGTAAATCTGGGAGCAAGTGGG + Intergenic
1033726294 7:144122037-144122059 TATTAAGTATGAAGTCAAGTGGG + Intergenic
1035757117 8:2042920-2042942 CAGGAAGCCTGGAGCCAAGAAGG - Intergenic
1037178097 8:15970930-15970952 CAGCAAGTTTGCAGGCAAGTTGG + Intergenic
1037415042 8:18640722-18640744 CAGTAAGACTGGAGGGAAGATGG + Intronic
1038302015 8:26360391-26360413 CAGTAATTCTGTAATCAGGTAGG + Intronic
1038807631 8:30809894-30809916 CAGTCAGGCTGGAGTGCAGTGGG - Intronic
1042893751 8:73642880-73642902 CAGTGTGGCTGGAGTGAAGTTGG + Intronic
1044950065 8:97427427-97427449 CTGTAAGTGTGGAGTCCACTGGG + Intergenic
1045064958 8:98436421-98436443 GAGCAAGTTTGGAGTGAAGTGGG - Intronic
1047321381 8:123787322-123787344 CAGTAAGAGTGGAGTCAAACAGG - Exonic
1048196409 8:132335401-132335423 CAGTGAGACTGGAGAGAAGTTGG - Intronic
1049143285 8:140977654-140977676 CACTTAGGCTGGAGTCCAGTTGG - Intronic
1050197816 9:3106926-3106948 CAGTCTGTCTGGAGTGAAGCAGG - Intergenic
1054702836 9:68431334-68431356 CAGGAACCCAGGAGTCAAGTTGG + Intronic
1056084639 9:83134148-83134170 CAGAAAGTCTGGATGTAAGTGGG - Intergenic
1057821569 9:98335326-98335348 CAGAAAATCTGAAGTCCAGTTGG - Intronic
1057983759 9:99688566-99688588 CATTATGTCTTGAGTCAATTAGG + Intergenic
1058049179 9:100389328-100389350 AAAGAAGTCTAGAGTCAAGTAGG - Intergenic
1058624965 9:106925493-106925515 TAGAAAGTCAGGAGTCATGTTGG + Exonic
1058936579 9:109774863-109774885 CAGGAACTCTGAAGACAAGTTGG - Intronic
1062175339 9:135159011-135159033 CAAAAAGGCTGGAGCCAAGTGGG + Intergenic
1186577699 X:10784484-10784506 CAGTCAGACTGGAGTGCAGTGGG + Intronic
1186594438 X:10965448-10965470 CTGTAAGTCAGAAGTCGAGTTGG - Intergenic
1186753929 X:12650012-12650034 CAGTAGGCCTGGAGGCACGTGGG + Intronic
1189714580 X:43852523-43852545 CATTAATTGTGGAGTCTAGTTGG + Intronic
1189864459 X:45311054-45311076 CAATAATTCTTGGGTCAAGTGGG - Intergenic
1192701623 X:73480913-73480935 CAGGAAGAATGGAATCAAGTTGG - Intergenic
1193258899 X:79381636-79381658 CAGTAAGAATGGAACCAAGTTGG + Intergenic
1195615890 X:106911555-106911577 CAGTCAGTGTGGATTCAAGGAGG - Intronic
1196613616 X:117742646-117742668 CACTAACTCTGGAGTGCAGTAGG + Intergenic
1196634334 X:117983780-117983802 CAGAAAGTCTGGAATAAAGATGG + Intronic
1201436189 Y:13961083-13961105 AAGTAAGACTGGAGTTAAATGGG + Intergenic