ID: 964786358

View in Genome Browser
Species Human (GRCh38)
Location 3:160400244-160400266
Sequence GTCTCCCTCCTCTCAGCGGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 140}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964786358_964786368 19 Left 964786358 3:160400244-160400266 CCGACCGCTGAGAGGAGGGAGAC 0: 1
1: 0
2: 0
3: 17
4: 140
Right 964786368 3:160400286-160400308 TCAACGGCGCCAGGAGCTAAAGG 0: 1
1: 0
2: 0
3: 3
4: 41
964786358_964786370 23 Left 964786358 3:160400244-160400266 CCGACCGCTGAGAGGAGGGAGAC 0: 1
1: 0
2: 0
3: 17
4: 140
Right 964786370 3:160400290-160400312 CGGCGCCAGGAGCTAAAGGGCGG 0: 1
1: 0
2: 0
3: 5
4: 86
964786358_964786369 20 Left 964786358 3:160400244-160400266 CCGACCGCTGAGAGGAGGGAGAC 0: 1
1: 0
2: 0
3: 17
4: 140
Right 964786369 3:160400287-160400309 CAACGGCGCCAGGAGCTAAAGGG 0: 1
1: 0
2: 0
3: 5
4: 38
964786358_964786361 -7 Left 964786358 3:160400244-160400266 CCGACCGCTGAGAGGAGGGAGAC 0: 1
1: 0
2: 0
3: 17
4: 140
Right 964786361 3:160400260-160400282 GGGAGACTTCGTTATGCCCCGGG 0: 1
1: 0
2: 0
3: 3
4: 56
964786358_964786362 3 Left 964786358 3:160400244-160400266 CCGACCGCTGAGAGGAGGGAGAC 0: 1
1: 0
2: 0
3: 17
4: 140
Right 964786362 3:160400270-160400292 GTTATGCCCCGGGCCGTCAACGG 0: 1
1: 0
2: 0
3: 0
4: 17
964786358_964786371 24 Left 964786358 3:160400244-160400266 CCGACCGCTGAGAGGAGGGAGAC 0: 1
1: 0
2: 0
3: 17
4: 140
Right 964786371 3:160400291-160400313 GGCGCCAGGAGCTAAAGGGCGGG 0: 1
1: 0
2: 0
3: 8
4: 164
964786358_964786360 -8 Left 964786358 3:160400244-160400266 CCGACCGCTGAGAGGAGGGAGAC 0: 1
1: 0
2: 0
3: 17
4: 140
Right 964786360 3:160400259-160400281 AGGGAGACTTCGTTATGCCCCGG 0: 1
1: 0
2: 1
3: 5
4: 77
964786358_964786365 10 Left 964786358 3:160400244-160400266 CCGACCGCTGAGAGGAGGGAGAC 0: 1
1: 0
2: 0
3: 17
4: 140
Right 964786365 3:160400277-160400299 CCCGGGCCGTCAACGGCGCCAGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964786358 Original CRISPR GTCTCCCTCCTCTCAGCGGT CGG (reversed) Intronic
900603740 1:3514812-3514834 GTCTCCCTCCTCCCAGGTGCGGG + Intronic
901455093 1:9358599-9358621 GCCTCCCTCCTCCCAGCCATGGG + Intronic
901945931 1:12703598-12703620 TTGTCTCTCCTCTCAGTGGTGGG + Intergenic
903262602 1:22139511-22139533 GTCCCCCTCCCCTCACCCGTGGG + Intronic
908253035 1:62280268-62280290 GGCTCCCTCCTTTCAGCCATGGG - Intronic
910704871 1:90118036-90118058 GTCTCCCTCCCCACAGGTGTGGG - Intergenic
913119691 1:115728447-115728469 TTTTCCCTCTTCTCAGGGGTAGG + Intronic
914858016 1:151366131-151366153 GTCTCTCTTCTCTCAGTGCTAGG - Intronic
917234493 1:172876120-172876142 GTCTCCCTCCTCCCAGCTCCTGG + Intergenic
917565463 1:176207689-176207711 GTCTCTCTCTTCTGAGGGGTAGG + Intergenic
923765466 1:236889059-236889081 GCCTCCCTCCTGTCACCCGTAGG - Intronic
924458012 1:244233617-244233639 GTCTCCCTCCAGACTGCGGTTGG - Intergenic
1062898025 10:1119694-1119716 GCCTCCCTCCTCCCAGCGAAGGG - Intronic
1063227392 10:4028299-4028321 CTCTCCCTCCTCTCTCCGCTGGG + Intergenic
1067057286 10:43059561-43059583 GTGTCTCTCCTCTCAGATGTGGG - Intergenic
1071375566 10:84998846-84998868 GTCTCCCTCCCATCATCGCTTGG - Intergenic
1072743779 10:97926093-97926115 GTCTGCCTCCACTCAGCGGAAGG - Intronic
1073151149 10:101312500-101312522 GTTGCCCTCCTTTCTGCGGTTGG + Intergenic
1074134133 10:110612450-110612472 GTCTCCATCCTCACAGCCTTGGG + Intergenic
1078205804 11:9228360-9228382 GTCTCTCTCCTCTCTGCAGGTGG - Intronic
1080110924 11:28566935-28566957 GTCTCCATGCTCTCCGCGGAAGG + Intergenic
1082068867 11:47922539-47922561 CTCTCCCTTCTCTCTGCAGTGGG + Intergenic
1083749996 11:64755603-64755625 GCCTCCCTCCCCTCAGGGCTGGG + Intronic
1084497294 11:69512570-69512592 GTCTCGCTCCTTTCAGTGGCTGG - Intergenic
1084650883 11:70488572-70488594 GGCTCCCTCCCCTCAGGGGCAGG - Intronic
1084702448 11:70796227-70796249 GTCTTCCTCCTCTCTCCTGTGGG - Intronic
1084944782 11:72632724-72632746 CCCTCCCTCCTCTCAGGGGAGGG - Intronic
1086103089 11:83121899-83121921 CTCTCTCTCCTCTCAGCTGAGGG + Intergenic
1086602843 11:88656273-88656295 TTCTCCCTCTTCTCACTGGTGGG + Intronic
1091288824 11:134425315-134425337 GTCTTCCTCCTCTTTGCTGTGGG + Intergenic
1092161758 12:6318906-6318928 TTCTCCCTCTTCTCAGCGAGGGG + Intronic
1095161511 12:38922697-38922719 CTCTCCCTTCTCTCAGAGGAAGG + Intergenic
1095570193 12:43675573-43675595 GTCTTCCTCCTCTCAGTGTCTGG - Intergenic
1096463277 12:51834541-51834563 GTCTGGCTCCTCTCTGGGGTGGG + Intergenic
1096980875 12:55727866-55727888 CTTTCCCTCCTCCCAGCGCTTGG - Intronic
1097279657 12:57837001-57837023 GCCTCCTTCCTCTCAGCTATTGG + Intronic
1099901623 12:88717727-88717749 CTCTCCCTCCTCCCAGCCCTAGG - Intergenic
1101926687 12:108977493-108977515 GTCTCCGTCCTCTCTGCAGATGG - Exonic
1102768181 12:115451298-115451320 GTCTCCTTCCTCTCGGCTGCAGG - Intergenic
1105240863 13:18609110-18609132 GTCGCCCTCCTCCAAGCGCTGGG - Intergenic
1106340596 13:28823074-28823096 CTCTTCCTCCTCTCAGAGGCAGG + Intronic
1108162050 13:47650978-47651000 CTCTCCCTCTTCTCAGCAGTCGG - Intergenic
1109492547 13:63121678-63121700 TTCTCCCTTCTCTCAGCCCTTGG - Intergenic
1115465799 14:33712935-33712957 GTCTCCCTCCTCTCATCAACAGG + Intronic
1119173814 14:72554727-72554749 CTCTCCCTCCTCTCATCTGACGG - Intronic
1119293600 14:73515809-73515831 GCCTCCCTCCTTTCTGGGGTAGG + Intronic
1119293664 14:73516284-73516306 GCCTCCCTCCTTTCTGGGGTAGG + Intronic
1119478095 14:74942683-74942705 GTCTCTCTCCTCCAAGGGGTGGG + Exonic
1120163008 14:81165377-81165399 GTCTGCCTACTCTCACAGGTGGG - Intergenic
1121459737 14:94065684-94065706 GCCTCCCTCCTCTCCACAGTTGG - Intronic
1121749350 14:96335728-96335750 TTCTCTCTCCTCTCAGCCTTAGG - Intronic
1123490496 15:20776028-20776050 GTCGCCCTCCTCCAAGCGGTGGG + Intergenic
1123546997 15:21345115-21345137 GTCGCCCTCCTCCAAGCGGTGGG + Intergenic
1128249883 15:66156555-66156577 TTCTCCCTCCTCTCGGGGGCCGG - Intronic
1202955329 15_KI270727v1_random:72331-72353 GTCGCCCTCCTCCAGGCGGTGGG + Intergenic
1132729648 16:1355118-1355140 GTCTCCCGCCTCTGCGGGGTCGG + Intronic
1135134132 16:19875201-19875223 GGCTGCCTCCTCTCATCAGTAGG - Intronic
1136350966 16:29707418-29707440 ATCTCCCTCCTCTCAGCCAATGG + Intergenic
1137496602 16:48974068-48974090 GTCTTCCTCATCTCAGGAGTGGG + Intergenic
1139962269 16:70724847-70724869 GTCTCCCTCCCCTCAGCTGGGGG + Intronic
1140653782 16:77118439-77118461 GTCTCTCTCCTCTCAGCCCTTGG + Intergenic
1145293340 17:21567798-21567820 GTACCCCTCCTCTCAGCCATAGG - Intronic
1147179192 17:38674133-38674155 CTCTTCCTCCTCTCCGCGGCGGG + Exonic
1147680440 17:42240475-42240497 TTCTCCCTCCCCTCAGCCCTTGG - Intronic
1148683616 17:49488376-49488398 GTCTCCCTCCTCAGAGCAGGGGG + Intergenic
1148735069 17:49860672-49860694 CTCTGCTTCCTCTCAGGGGTGGG - Intergenic
1154338419 18:13483872-13483894 GTCTCTCTCCTCTCAGTAGCAGG + Intronic
1154448107 18:14450798-14450820 GTCGCCCTCCTCCAAGCGCTGGG + Intergenic
1155102859 18:22630360-22630382 TTCTCCCTCCTTTCAACTGTTGG - Intergenic
1163700850 19:18785845-18785867 GTCTCCCACCTCTCAGGGGACGG - Exonic
1167278564 19:48553242-48553264 GTCTCCCTCCTCACAGCCCACGG - Intronic
1167524455 19:49975053-49975075 GACGCCCTCCTCTCAGAGCTCGG + Intergenic
926290326 2:11524160-11524182 TTCTCCCTCCTCTCAGTAGAAGG + Intergenic
926679815 2:15654614-15654636 GTCTCCCTCCACTCAGCCGCAGG + Intergenic
929818842 2:45257571-45257593 CTCTGCCTCCGCTCAGCGGGAGG + Intergenic
930581832 2:53220872-53220894 GTCTTCCTCCTCTCTGCAGCTGG + Intergenic
932087037 2:68771691-68771713 GTCTCCCTACCCTCAGGGTTTGG + Intronic
933942466 2:87255874-87255896 GCCTCCCTCCTCTGTGCTGTTGG + Intergenic
935137699 2:100322001-100322023 GTCGCCCTCCTCTAAGCGCTGGG + Exonic
936337759 2:111605694-111605716 GCCTCCCTCCTCTGTGCTGTTGG - Intergenic
943989628 2:194671259-194671281 GTCTCACCCCTCTCAGTGTTCGG - Intergenic
945021544 2:205577766-205577788 GTCTCCCTGCTCTCATCAGATGG + Intronic
947886325 2:233574921-233574943 TTCTCCCTCCTCCCAGCCCTTGG + Intergenic
948566068 2:238887150-238887172 CTCTTCCTCCTCTAAGGGGTGGG - Intronic
1171483240 20:25469009-25469031 GTCTCCCGACTCTCACTGGTGGG + Intronic
1171997019 20:31739388-31739410 GTCTCCCTCCTCCCGGAGTTTGG + Exonic
1172527674 20:35610105-35610127 GTCTCCCTCCTCTGAGCTCCTGG - Intergenic
1173183866 20:40824485-40824507 CCCTCCCTCCTCTCAGCAGATGG + Intergenic
1174084761 20:47999089-47999111 GTCTTACTCCTCTCAGCAGCAGG + Intergenic
1174365402 20:50053460-50053482 GTTTCCCTCCTCTGAGCAATGGG - Intergenic
1175366641 20:58460716-58460738 GACTCCCTCCTGGCAGCTGTAGG - Exonic
1175576297 20:60063197-60063219 CTCTCCCTCCTCTCAGCTCTGGG - Intronic
1178695987 21:34792938-34792960 GTCTCCGTCCTCTCAGGAGGTGG - Intronic
1181960171 22:26617054-26617076 GTCTGCTTCCTCTGAGGGGTTGG + Intronic
1182603943 22:31489401-31489423 GCCTCCCTCCTCCCTGCGGCCGG - Exonic
1184394070 22:44222262-44222284 GTCTCCCTCCCCTCAGCCAACGG - Intergenic
950423577 3:12912761-12912783 CTCTCCCTTCTCTCTGCAGTGGG + Intronic
950952594 3:17016452-17016474 GCCTCCCTCCTCTCTGCAGGAGG - Intronic
952411088 3:33050612-33050634 CTCTCCCTCCTCTCAGCCCCTGG - Intronic
953419242 3:42741847-42741869 GTTTCCCTCCTCACAGCTGATGG + Intronic
953687447 3:45089111-45089133 GTCATCCTCATCGCAGCGGTGGG - Exonic
953931069 3:47005930-47005952 GCCTCCCTACTCTCAGGAGTCGG + Exonic
959624606 3:108435467-108435489 TTCTCCCTCCTCCCAGCCCTTGG + Intronic
961036790 3:123648049-123648071 CTCTCCCCTCTCTCAGCAGTAGG - Intronic
962182849 3:133226656-133226678 GGCTCCCTCCTCTCAGCCAAGGG - Intronic
962407173 3:135110354-135110376 GTGTCCCTCATCTAAGGGGTCGG - Intronic
962687842 3:137864692-137864714 CTCTCCCTTCTCTTAGCTGTGGG - Intergenic
964786358 3:160400244-160400266 GTCTCCCTCCTCTCAGCGGTCGG - Intronic
964811106 3:160665755-160665777 TTCTCCCTCCTCTCAGCAAATGG + Intergenic
966684192 3:182676171-182676193 GTCTTCCTCATCTCAGCGAATGG + Intergenic
967839263 3:193991635-193991657 ATATCCCTCCTCTGAGTGGTTGG + Intergenic
968585686 4:1414929-1414951 GCCCCCCTCCTCTCGGCGGTTGG + Intergenic
969870305 4:10100531-10100553 ATCTCCCTCATCTCAGAGGATGG - Intronic
970804715 4:20017469-20017491 TTCTCTCTCCTCTCAGGAGTGGG - Intergenic
979610806 4:122687050-122687072 TTCTCCCTCCCCCCAGAGGTGGG - Intergenic
980769929 4:137357806-137357828 GTCTTCCTTGTCTCAGAGGTCGG - Intergenic
982096240 4:151926108-151926130 CTTTTCCTCATCTCAGCGGTTGG - Intergenic
984669419 4:182465380-182465402 GTCTCCCTCCACACAGCAGCCGG - Intronic
988494364 5:31732467-31732489 GGCTCCATCCTCTTAGAGGTGGG - Intronic
991939706 5:71838750-71838772 GTCTGCCACCTCTGAGGGGTAGG - Intergenic
994528824 5:100940113-100940135 GTCTCCATCCTGTCAGCATTTGG + Intergenic
1001589656 5:172856662-172856684 TGCTCCCTCCTCTAAGCTGTAGG - Intronic
1003490823 6:6620056-6620078 GTCTTCCTCCTCTCAGGGGAAGG - Intronic
1005814788 6:29541740-29541762 GTCTTCCTCCTCCCAGCTCTTGG + Intergenic
1006517546 6:34553215-34553237 CTCTCCCACCTCTCAGCAGCCGG - Intronic
1010047874 6:71468921-71468943 CTCTCCCTCCTCTAAGCCCTAGG - Intergenic
1012958168 6:105592997-105593019 GTCTCTCTCCCCTCAGCAGTGGG + Intergenic
1013636509 6:112034031-112034053 GTCTCCTGCCTCTCAGAGGAGGG - Intergenic
1017205450 6:151800263-151800285 CTCTCCCTCCTCTCAGGTGTGGG - Intronic
1017904927 6:158751446-158751468 GAATCCCACTTCTCAGCGGTTGG + Intronic
1019658346 7:2209829-2209851 GATCCCCTCCTCTCAGCCGTGGG - Intronic
1022414503 7:30166517-30166539 GTCTCCCTCCTCATAGCGAAAGG + Intergenic
1023021408 7:36015062-36015084 GACTCCCTCGTCTCCGAGGTCGG + Intergenic
1024471752 7:49773764-49773786 GCCTCGCTCCTCTCCGCGGAGGG - Exonic
1032106731 7:129037859-129037881 TTTTCCCTTCTCTCAGTGGTAGG - Intronic
1033545309 7:142394281-142394303 GTCTCCCTCCACTCAGACGCAGG + Intergenic
1034264103 7:149773044-149773066 GTCTCCCTCAGCGCCGCGGTTGG - Intronic
1034622063 7:152464018-152464040 GTCTCCCTCCTCTCGGGGGGAGG - Intergenic
1036398488 8:8387549-8387571 ATCTTCCTCCTCTCAGTGGGTGG - Intergenic
1038447741 8:27615557-27615579 TTCTCCCTGCTCTCAGCAGAAGG - Intergenic
1038816625 8:30911812-30911834 GTTTCCATCCTCTCCGCGCTCGG - Intergenic
1040448905 8:47524540-47524562 GTGTCCCTCCTCAGAGCCGTGGG + Intronic
1041223314 8:55673397-55673419 CTCACCCTCCTCTCATCAGTAGG - Intergenic
1055354030 9:75418753-75418775 GACTTCCTCCTCTCAGCAGTTGG + Intergenic
1057296914 9:93851714-93851736 GGCTGCCTCCTCTCTGGGGTAGG + Intergenic
1057841423 9:98488296-98488318 GTCTCCCTCCTCTCTCTGCTGGG + Intronic
1058945074 9:109848320-109848342 GTCCTCCTGCTCTCAGCTGTGGG + Intronic
1061129721 9:128702286-128702308 GTCTCTCTCCTCGGAGTGGTTGG - Intergenic
1061536268 9:131252213-131252235 GTCCCCCTCCTCTCAGGTCTCGG - Intergenic
1062204994 9:135331399-135331421 TGCTCTCTCCTCTCAGGGGTGGG - Intergenic
1186558999 X:10590326-10590348 GTCTCTCTTCTCTCAGTTGTAGG + Intronic
1187648270 X:21373949-21373971 GTCCCCCTCCCCTCGGTGGTGGG + Intergenic
1187987348 X:24828691-24828713 ATCTACCTCCTCTCAGTGCTGGG - Intronic
1188117525 X:26263558-26263580 TTCTCCCTCCCCTCAGGGGTTGG - Intergenic
1190372934 X:49760496-49760518 GTCACCCTCCACTCAGCCCTTGG + Intergenic
1190390101 X:49922954-49922976 GTCTACCTCCTCTAAGCGCCGGG - Intronic
1198248863 X:134859950-134859972 GTCTCCCTCTTCTGAGAGGAAGG + Intergenic
1199829293 X:151533214-151533236 GTCTCCCTCCTCCCAGCTCCTGG + Intergenic