ID: 964786930

View in Genome Browser
Species Human (GRCh38)
Location 3:160406973-160406995
Sequence GGGACCGAGGCTCCCAAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964786930_964786935 30 Left 964786930 3:160406973-160406995 CCTACTTTGGGAGCCTCGGTCCC 0: 1
1: 0
2: 1
3: 5
4: 89
Right 964786935 3:160407026-160407048 AGCTCTGTATAACATTTCTTGGG 0: 1
1: 0
2: 0
3: 15
4: 254
964786930_964786934 29 Left 964786930 3:160406973-160406995 CCTACTTTGGGAGCCTCGGTCCC 0: 1
1: 0
2: 1
3: 5
4: 89
Right 964786934 3:160407025-160407047 TAGCTCTGTATAACATTTCTTGG 0: 1
1: 0
2: 0
3: 18
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964786930 Original CRISPR GGGACCGAGGCTCCCAAAGT AGG (reversed) Intronic
900159169 1:1215389-1215411 CGGACTGAGGGTCCCTAAGTTGG + Intergenic
903840330 1:26234320-26234342 AGGACTGAGGCTCCCGAAGGAGG - Intronic
905776850 1:40673481-40673503 GGGACCGAGGGTACAGAAGTAGG + Intergenic
909433348 1:75615130-75615152 GGAACCCGGGCTTCCAAAGTTGG - Intergenic
912878871 1:113390083-113390105 GGGACCGAGCTCCCCGAAGTGGG - Intergenic
915313685 1:155016855-155016877 GGGGCAGAGGCTCCCCAAATTGG + Exonic
915554647 1:156654653-156654675 GGGACAGAGGCTCTCAAACTTGG - Intronic
915985367 1:160459042-160459064 GGGACTGAGCTTCCCAGAGTTGG + Intergenic
919726403 1:200887617-200887639 GGGTCCAAGTCTCCCCAAGTGGG + Intergenic
919978351 1:202627383-202627405 GGGACGGAGGTTGCCAGAGTTGG - Intronic
922364518 1:224851483-224851505 GGGACTGTGCCTCCCAAGGTAGG + Intergenic
923144317 1:231187237-231187259 TGGCCCCAGGCTCCCCAAGTGGG + Intronic
1062895577 10:1100887-1100909 GGGCCCGAGGCTCACAAGGCTGG - Intronic
1065483802 10:26217681-26217703 GGGACCGGGGCGGCCAAGGTCGG + Intronic
1068598679 10:58933023-58933045 GGGACAGAGGCTCCCGCACTAGG - Intergenic
1070328558 10:75402934-75402956 CAGACCGAGGCTCCCAGAGGTGG - Intergenic
1083755943 11:64791818-64791840 AGGGCCAAGGCTCCCAAACTAGG - Intronic
1085383361 11:76140509-76140531 TGGAAGGAAGCTCCCAAAGTTGG + Intronic
1085784248 11:79437555-79437577 GCCACCGAGGAGCCCAAAGTTGG + Intronic
1087133742 11:94693728-94693750 GGGACCGTGGCTCAGAGAGTTGG + Intergenic
1088068469 11:105752025-105752047 GGGACAGAAGCTCGCAAAGGAGG - Intronic
1089614779 11:119688995-119689017 GGGAGGGAGGCTGCCAAGGTAGG + Intronic
1091739493 12:2950399-2950421 GGAACCGAGGCTCACTTAGTAGG + Intergenic
1096407426 12:51354120-51354142 GAAATAGAGGCTCCCAAAGTAGG - Exonic
1115643076 14:35347674-35347696 GGGACAGAGGCTGCCTGAGTGGG - Intergenic
1119517455 14:75259280-75259302 TGGCCCGAGGCTTCCAAAGGCGG + Intronic
1121721666 14:96113155-96113177 AGGAACAAGGCTCCCAGAGTTGG - Intergenic
1124493977 15:30175322-30175344 GGGACAGAGGTTGCCAGAGTTGG - Intergenic
1124749592 15:32363324-32363346 GGGACAGAGGTTGCCAGAGTTGG + Intergenic
1129753892 15:78084373-78084395 GGGACCGAGGCTCAGACAGATGG + Intronic
1129875521 15:78973170-78973192 TGGACCCAGGCTCCCAAATGGGG + Intronic
1136540155 16:30924195-30924217 GGGACTGAGCCTCCCAGAGCAGG + Intronic
1137590085 16:49688006-49688028 GGGACCCAGGGACCCACAGTGGG + Intronic
1139429404 16:66903200-66903222 GGGCGGGAGTCTCCCAAAGTGGG + Intergenic
1144830112 17:18126506-18126528 GGGATCCAGGCTCCCAGAGCAGG - Intronic
1145103601 17:20096897-20096919 GGGAAGGAGGCTCCCAAGGAGGG + Intronic
1147166483 17:38596216-38596238 GGGGCAGGGGCTCCCAAAGTGGG + Intronic
1148743227 17:49904564-49904586 GGGACCCAGGCTGGCAAGGTAGG - Intergenic
1149534270 17:57420386-57420408 GAGACAAAGGCTCCAAAAGTGGG - Intronic
1155183386 18:23367411-23367433 GGGACTGGGGCCCCCACAGTGGG + Intronic
1157669721 18:49518114-49518136 GGTACCGTGGCTCACCAAGTTGG + Intergenic
1158896504 18:61918981-61919003 GGGACAGAGGCTCCCCAGCTAGG - Intergenic
1165795320 19:38516028-38516050 GGGACCCAGGACCCCAAAGAGGG + Intronic
1166765180 19:45248716-45248738 GGGACCGAGGCTTACAGAGAGGG - Intronic
1167574865 19:50313072-50313094 GGGACCCCGGCTCCAAAAGGGGG + Intronic
1168064147 19:53909703-53909725 GGGTCCGAGGGTCCCGGAGTGGG + Intronic
1168098651 19:54129212-54129234 GGGACCGAGGGACACAAGGTGGG + Intronic
928123165 2:28598560-28598582 GGGACCTAGGTCCCCAAAGTGGG - Intronic
930714410 2:54579458-54579480 GGGACCGTGGCCCCCAATGAGGG + Intronic
933723656 2:85413930-85413952 GGGACCTGGGCTCCCCATGTAGG - Intronic
935175109 2:100642475-100642497 CGGACCTGGGCTCCCAAAGCTGG + Intergenic
938780212 2:134577711-134577733 GGCACGGAGGCTCCCAAGGGTGG - Intronic
943528307 2:189046841-189046863 GGCACAGTGGCTCACAAAGTGGG + Intronic
1176104787 20:63380863-63380885 GGGAGGGAGGCGCCCAAAGGCGG + Intergenic
1176158087 20:63633079-63633101 GGGACGGTGGCTGCCAGAGTGGG + Intergenic
1180176342 21:46092052-46092074 GAGACCGAGGCTCCCGGAGGAGG - Intergenic
1180221920 21:46364684-46364706 GGGACTGAGGCTCGCAAAAAGGG - Intronic
1181755855 22:25024205-25024227 GGGTTCAAGGTTCCCAAAGTGGG + Intronic
951599643 3:24359362-24359384 GTGACTGAGGCTCCAAAAGCAGG + Intronic
953397211 3:42582464-42582486 GGGACCGAGGCACCCACAGATGG + Intronic
953868628 3:46606818-46606840 GCCCCCGAGGCTCCCAAACTTGG - Intronic
954089988 3:48276634-48276656 GGTACCAAGGCACCCCAAGTTGG + Intronic
954434793 3:50490292-50490314 GGCACTGAGGCTCCCAGGGTTGG - Intronic
954623154 3:52007064-52007086 GAGACCGAGGCTCAGAAAGGGGG + Intergenic
954706869 3:52485614-52485636 GGGCCCCAGGGTCCCAGAGTGGG + Intronic
954752132 3:52819643-52819665 GGGGGAGAGGCTCCCCAAGTTGG - Exonic
963962283 3:151322909-151322931 TGGACCCAGGCTCCAAAAATAGG - Intronic
964786930 3:160406973-160406995 GGGACCGAGGCTCCCAAAGTAGG - Intronic
968987050 4:3881154-3881176 GAAACCGAGGCTCCCAGAGGCGG + Intergenic
969728781 4:8940989-8941011 GAAACCGAGGCTCCCAGAGGCGG - Intergenic
972751120 4:41990407-41990429 GGGACCCAGACTCCCAAAGTGGG - Intergenic
973774641 4:54232443-54232465 GGGAAGGAGGCGCCCCAAGTCGG - Intronic
978427035 4:108593804-108593826 CGCACCTCGGCTCCCAAAGTGGG + Intergenic
986721465 5:10563936-10563958 GGGTCCGAGGTTCCCGAAGCTGG + Intergenic
992294084 5:75309711-75309733 GCTACGGAGGCTCCCAAACTTGG - Intergenic
995748406 5:115428138-115428160 GGGAGAGAGATTCCCAAAGTAGG + Intergenic
997720016 5:136070707-136070729 GGGACCGAGGCACACATAGCTGG - Intergenic
1003248690 6:4405682-4405704 GGGGCCTAGGGTCCCAAACTTGG + Intergenic
1006450603 6:34103780-34103802 GAGACTGAGGCTCACAAAGGAGG - Intronic
1018735782 6:166686306-166686328 GGGCCAGAGGGTCCCACAGTAGG - Intronic
1020967358 7:14888252-14888274 GAGACAGAGGCTCCAAAGGTAGG + Intronic
1034278945 7:149838512-149838534 GGGACCCAGGCTCCCGGAGGGGG - Exonic
1036135102 8:6153012-6153034 TGGCCCGAGCCTCCCCAAGTAGG + Intergenic
1036204375 8:6794380-6794402 GGGACCGGGGTTCCCAAGGCTGG + Intergenic
1042940467 8:74101943-74101965 GGGACCCATGCTCCCACTGTGGG - Intergenic
1042943325 8:74129611-74129633 TGGACCAAGGCCCCCAAAGGAGG - Intergenic
1051691274 9:19715384-19715406 GGGACCGAGTATCCTCAAGTAGG + Intronic
1053105841 9:35406830-35406852 GAGCAAGAGGCTCCCAAAGTGGG + Intergenic
1057302417 9:93894546-93894568 GGGACCTTGCCTTCCAAAGTGGG + Intergenic
1057849586 9:98554989-98555011 GAGACTGAAGTTCCCAAAGTTGG - Intronic
1058005195 9:99906726-99906748 GGGCCCGACGCCCCCAAAGGCGG - Intronic
1059476897 9:114554584-114554606 GGGACAGAGGCTCCTGAACTCGG - Intergenic
1059633854 9:116154097-116154119 GGCGCCGAGGCTCCCAAAGCTGG + Exonic
1060945098 9:127565854-127565876 GAGGCCAAGGCTCCCAAAGGAGG + Intronic
1193083262 X:77426082-77426104 GGGACCTAGGCTAACAGAGTGGG + Intergenic
1201595103 Y:15659568-15659590 GGTAACAAGGCTCCCACAGTGGG + Intergenic