ID: 964786947

View in Genome Browser
Species Human (GRCh38)
Location 3:160407250-160407272
Sequence TAAAGTTTGAAACACGAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 104
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 97}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964786947 Original CRISPR TAAAGTTTGAAACACGAACC AGG Intronic
901721903 1:11205553-11205575 TAAAGTTAGAAACACCTGCCTGG + Intronic
905533169 1:38698267-38698289 TAAAATCTGAAAGATGAACCTGG - Intergenic
907218372 1:52885502-52885524 GAAAGGTTAAAACACAAACCAGG - Intronic
907717578 1:56941672-56941694 CAAATTATGAAACACGTACCTGG + Intronic
908558412 1:65281220-65281242 TAAAATTTGAAACTTGAGCCGGG - Intronic
908805449 1:67926239-67926261 TAAAGTTTGAAACATGATTTTGG + Intergenic
909370259 1:74875453-74875475 TAAAATTTGAGAGACAAACCTGG - Intergenic
910238043 1:85056039-85056061 TGAAGCTTGTAACAGGAACCAGG + Intronic
916003061 1:160634853-160634875 TAAAGTTTTAAACAAGACCCAGG - Exonic
916232757 1:162556650-162556672 TAAAATTTGAAACACCAAAATGG - Intergenic
916299846 1:163261684-163261706 AAAGGTTTGAAAAACAAACCAGG + Intronic
917361440 1:174180904-174180926 TAAAGCATGAAACAAGTACCAGG - Intronic
918906234 1:190499221-190499243 TAAAGTTTTAAACACTAATGTGG + Intergenic
919447672 1:197729221-197729243 TAAAATTTGAAACATGATTCTGG - Intronic
1066304370 10:34125657-34125679 TAAAGTCTGAAACAGGAAAAGGG + Intronic
1069252987 10:66294998-66295020 TATAGTTTGAAAGAGGAACTTGG + Intronic
1071780573 10:88839866-88839888 TAATGTTTAAAACACGACCCAGG + Intronic
1074279805 10:112040207-112040229 TAAAGTATAAAACAAGAATCAGG - Intergenic
1074977175 10:118590905-118590927 TTAAGTTTGAAACACTTACATGG - Exonic
1075033227 10:119041240-119041262 TAAAGTGTGAAACAATAAGCAGG + Intronic
1083496438 11:63058291-63058313 TACAGTTTGCACCACGCACCTGG - Intergenic
1091143369 11:133255212-133255234 TAAAGTGTGAAGCACGAAACTGG + Intronic
1092268629 12:7003509-7003531 TAAAATTTGAAAACCCAACCTGG - Intronic
1099090884 12:78306278-78306300 TAAAATTTGAAATATGATCCAGG + Intergenic
1099339221 12:81407136-81407158 TTAAGTTTGAAAGATGTACCTGG - Intronic
1106980720 13:35276270-35276292 TAAATTTTTAAATGCGAACCAGG + Intronic
1115409742 14:33060661-33060683 ACAGGTTTGAAACACTAACCAGG - Intronic
1115746999 14:36448307-36448329 TAAAATTTTAAAAAAGAACCTGG - Intergenic
1120720219 14:87882474-87882496 TCAAGTTTTAAACACTAATCAGG + Intronic
1126407161 15:48332521-48332543 TAAAATTTTAAACACGAAAAAGG - Intronic
1126868680 15:52963993-52964015 TAAACTTTGAAACTCAAGCCAGG + Intergenic
1127313657 15:57774675-57774697 TAAATTCTAAAACACAAACCTGG + Intronic
1129619549 15:77131780-77131802 TAAAGTCAGAAACATAAACCAGG + Intronic
1131657902 15:94481168-94481190 TAAAGTTTGAGAAGGGAACCAGG - Exonic
1132457239 16:30944-30966 TATAATTTGAACCATGAACCGGG - Intergenic
1134064844 16:11221399-11221421 TAAAGTGTGAAAGAGGAGCCGGG + Intergenic
1138144004 16:54592511-54592533 TAGCGTTTTAAACAGGAACCTGG - Intergenic
1151458518 17:74240993-74241015 TTAAGTTTGAAACATGAACTGGG + Intronic
1164291774 19:23876191-23876213 TAAACTCTTAAACAAGAACCAGG + Intergenic
1165409667 19:35651497-35651519 TAAAGTTTGTAACCCTAGCCTGG - Intronic
930261274 2:49149432-49149454 TAAAGTCTGAACCACAACCCAGG - Intronic
930503659 2:52255501-52255523 AAAAGTTTGAATCATGCACCTGG - Intergenic
931119748 2:59203236-59203258 TAAAGTTTTAAGCAGAAACCAGG - Intergenic
931623226 2:64231968-64231990 TTAAGTTTGATACATGAAGCAGG + Intergenic
939034667 2:137116436-137116458 CAAGGTTTGAAAAACTAACCTGG - Intronic
941016583 2:160364330-160364352 TAAATTGTGAAACACGTACGAGG - Intronic
942557095 2:177183117-177183139 TAAAGTTGGAATGACAAACCTGG - Intergenic
942897781 2:181078678-181078700 TAAAGTTTGAAAATCTGACCAGG - Intergenic
946090828 2:217221518-217221540 TCAAGTTTGAAGCACTAAGCTGG + Intergenic
946124672 2:217552163-217552185 TATAGTTGGAAACAAGAGCCTGG + Intronic
1169682254 20:8228481-8228503 CAGAGTTTGAAACACTGACCTGG - Intronic
1183110452 22:35644978-35645000 TAAAGGTTGATGCACGCACCAGG - Intergenic
950320152 3:12044127-12044149 TAAAGGTTGACACTAGAACCTGG - Intronic
952244132 3:31566779-31566801 TACAGTTTGAAACAAGAGCTGGG - Intronic
955106524 3:55904043-55904065 TGAATTTTTAAACACGAAACAGG - Intronic
955906509 3:63813509-63813531 TTAAGTTAGAAATACTAACCTGG + Intergenic
957680901 3:83433059-83433081 TAAAGTTTGAATGATTAACCTGG + Intergenic
958039047 3:88204435-88204457 AAAAGTTTGAAAAACAAACAAGG + Intergenic
958061745 3:88492404-88492426 TGAAGTTTGAAAAAAGAAACAGG - Intergenic
958829218 3:99067304-99067326 TAAACTTTAGAACACAAACCTGG - Intergenic
964786947 3:160407250-160407272 TAAAGTTTGAAACACGAACCAGG + Intronic
966677571 3:182605761-182605783 TATAGTGTGAAAAACAAACCAGG + Intergenic
968779518 4:2569656-2569678 TAAAGTTTTAAAAATTAACCGGG - Intronic
974472779 4:62339520-62339542 TAAAGTCTGAAGCCAGAACCAGG - Intergenic
974496902 4:62641605-62641627 TAATTTCTGATACACGAACCAGG - Intergenic
975078590 4:70245997-70246019 GAATGTTTGAAAGACGAATCCGG - Intronic
980272598 4:130605663-130605685 TAAAGTTAAAAACTTGAACCAGG - Intergenic
982831175 4:160062604-160062626 TATAGTTTTAAACACCAACTTGG - Intergenic
984262125 4:177454580-177454602 TAAATTTTGAAAGACAAAACCGG + Intergenic
985625055 5:981545-981567 CATAATTTGAAACAAGAACCTGG + Intergenic
994110287 5:95995366-95995388 TAAAGTTTGATAGAAGAAGCAGG - Intergenic
994588174 5:101738225-101738247 TAAAGTTTTAAAAACCATCCTGG + Intergenic
994722841 5:103400714-103400736 TAAAGTCTGAGACAAGGACCTGG + Intergenic
1004976424 6:20972506-20972528 GAAAGTTTGAAACAGAAAGCAGG + Intronic
1007936132 6:45733604-45733626 TAAATTTTAAAAAAAGAACCTGG - Intergenic
1012854349 6:104484280-104484302 TAAATTTTGAAACACCAAGGAGG - Intergenic
1013936491 6:115602161-115602183 TAAATTTTGAAAGACAAATCTGG + Intergenic
1014072598 6:117200617-117200639 GAAAGTGTGAAACAAGAACAAGG - Intergenic
1020729298 7:11861526-11861548 TAAAGTTTGAAATGAGAACTAGG + Intergenic
1023422963 7:40003399-40003421 TAAAGTTAAAAAGACAAACCAGG - Intronic
1028155896 7:87429072-87429094 TCAAGTTTCAAAGACCAACCTGG - Intronic
1031055855 7:116992123-116992145 TACAGTTTGCATCATGAACCTGG - Intronic
1034751356 7:153571778-153571800 TACAGTTTGCAACATGCACCTGG + Intergenic
1035069192 7:156128635-156128657 TAATGTTTTAAACACGAATCAGG - Intergenic
1036037467 8:5034864-5034886 TAAAATTTAAAAAAAGAACCTGG + Intergenic
1036961188 8:13246052-13246074 AAAAGTATAAAACATGAACCAGG + Intronic
1039968690 8:42303253-42303275 TTAAGTTTTAAACAAGAAACAGG + Intronic
1042015973 8:64312040-64312062 TAAAGTTTAAAACAGGAAGATGG - Intergenic
1044482129 8:92703361-92703383 TAAAGTTTAAAGCAATAACCTGG - Intergenic
1046161471 8:110372212-110372234 TAAAGTTATAAAAACGAAACAGG + Intergenic
1046437925 8:114218091-114218113 TAAATTTGGAAACATGGACCTGG + Intergenic
1048818906 8:138361385-138361407 TAAATTTTGAAAGAAGAAACAGG + Intronic
1049262654 8:141647967-141647989 CAAAGTTTGAACCAGGATCCTGG + Intergenic
1050955134 9:11647278-11647300 TAAAGTTGGAAACTCCAACATGG - Intergenic
1055063150 9:72091556-72091578 TGAATTTGGAAACACTAACCAGG - Intergenic
1055325295 9:75122098-75122120 TAAAGTGTCAACCACGGACCTGG + Intronic
1058040385 9:100295719-100295741 TAAAGATTGAAACAGGATCCTGG + Intronic
1062635763 9:137490252-137490274 TAAAATTTGAAAAATGATCCAGG - Intronic
1188964824 X:36537737-36537759 TGCAGTTTGAATCATGAACCTGG - Intergenic
1189285442 X:39849046-39849068 TAAACAGAGAAACACGAACCTGG - Intergenic
1193954080 X:87836851-87836873 TAAATTATGAAAAAAGAACCAGG - Intergenic
1196123937 X:112080277-112080299 GAAAGTTTAACAGACGAACCTGG + Intronic
1197899997 X:131360724-131360746 TAAAATTTGAAGCACCAACTAGG + Intronic
1200399118 X:156008441-156008463 TATAATTTGAACCATGAACCGGG + Intronic