ID: 964787416

View in Genome Browser
Species Human (GRCh38)
Location 3:160413303-160413325
Sequence CTGGGTCAAGGCTAGAATTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 3, 3: 17, 4: 144}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964787416_964787424 2 Left 964787416 3:160413303-160413325 CCTAAATTCTAGCCTTGACCCAG 0: 1
1: 0
2: 3
3: 17
4: 144
Right 964787424 3:160413328-160413350 GGATTTTCCCCTCATAGCCTAGG 0: 1
1: 0
2: 0
3: 11
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964787416 Original CRISPR CTGGGTCAAGGCTAGAATTT AGG (reversed) Intronic
901457090 1:9369311-9369333 CTGGGTCAAGGCCATAAGCTGGG - Exonic
901832818 1:11903867-11903889 CTGGGCCATTGCTAGATTTTTGG - Intergenic
902936867 1:19770685-19770707 CTGGCTCACGTCTAGAATCTAGG - Intronic
904873622 1:33636779-33636801 GTGGGTCAAGGCAAGAACATGGG - Intronic
908825746 1:68131333-68131355 CTGGGTCTAGCCTAGCATATCGG + Intronic
909217729 1:72912354-72912376 CTGGGTTCATACTAGAATTTTGG - Intergenic
912788305 1:112625658-112625680 CTGGGTCAAGGCAAGATTATGGG - Intronic
915448961 1:155991333-155991355 CAGACTCAAGGCTAGAACTTAGG + Intronic
916153160 1:161816538-161816560 AAGGGCCAAGGCTAGAACTTAGG - Intronic
917156738 1:172009445-172009467 GTGGATAAAGGCTAGAATATTGG - Intronic
918202335 1:182279194-182279216 CTGAGTCAAGGGTATAAATTGGG + Intergenic
919975139 1:202605547-202605569 GTGGGGCAAGGCTAGAGTCTGGG - Intronic
920170056 1:204066282-204066304 TAGGGTCTAGGCTAGAATCTAGG + Intergenic
921369576 1:214407779-214407801 CTGGGCAAAGGATATAATTTAGG - Intronic
921727021 1:218535050-218535072 CTGGGAGAAAGCTAGAATTTAGG + Intergenic
1064244135 10:13656191-13656213 TTGGGTCAAGCCTAGAGATTTGG - Intronic
1064247560 10:13681186-13681208 CTGGCAGAAGGCTAGAAGTTAGG - Intronic
1067715909 10:48691115-48691137 CTGGGTCCAGGCCAGAATTTGGG + Intronic
1069260804 10:66393618-66393640 CTGTGTGAAGGCTAGAAACTTGG - Intronic
1070047080 10:72848862-72848884 CTGGAGCAAGGCTGGAATTAAGG + Intronic
1071730813 10:88246660-88246682 CTCTCTCACGGCTAGAATTTTGG + Intergenic
1071783980 10:88879298-88879320 CTGAGCCAGGGCTAGAATTTTGG + Intergenic
1072054229 10:91738276-91738298 CTTGGTCAAGTGTAGAGTTTAGG + Intergenic
1072686528 10:97540736-97540758 CTGGGTCCAGGCTAGGAGCTGGG + Intronic
1077292606 11:1805357-1805379 CTGGGTCAAGGTCACATTTTTGG + Intergenic
1078752961 11:14182373-14182395 AGGGGCCAAGGTTAGAATTTAGG - Intronic
1081756653 11:45549552-45549574 CTGCGTGCAGGCTAGAATCTTGG - Intergenic
1083587427 11:63870395-63870417 CTGGGTCAGGGCTAGAATGCTGG - Intronic
1083900880 11:65642708-65642730 CAGGGTCAAGGCTAGGGGTTTGG - Intronic
1085641026 11:78192836-78192858 ATGAGTCAGGGCTAGAATGTAGG + Intronic
1087290405 11:96314681-96314703 TTGACTCAGGGCTAGAATTTGGG - Intronic
1087643619 11:100782697-100782719 CTTTGTCAAGGATAGAATTCAGG + Intronic
1088584355 11:111347819-111347841 CTGGGGCAAGCCTGGACTTTTGG - Intergenic
1088972197 11:114783399-114783421 CTGGGTCTTTGCTAGAAATTAGG - Intergenic
1093342682 12:17998164-17998186 CTGGGGCAAGCCTAGAAGCTAGG - Intergenic
1093549919 12:20396456-20396478 CTTGGTCAAGGATAGAGTTCTGG - Intronic
1103518360 12:121521771-121521793 CTGGCTCCAGGCTAGGAGTTTGG - Intronic
1108207944 13:48109632-48109654 CTGATTTAAGGATAGAATTTAGG + Intergenic
1110399650 13:75074995-75075017 CTGGGTAAATGGGAGAATTTAGG - Intergenic
1110711315 13:78653992-78654014 CTGGTTCTGGGCCAGAATTTAGG + Intronic
1110858202 13:80319955-80319977 GTGGCTCAAGCCTATAATTTGGG - Intergenic
1111032306 13:82619246-82619268 ATGGTTGAAGGCTAAAATTTAGG + Intergenic
1114362091 14:21985428-21985450 CTGTGGCAAAGCTAGAATGTTGG + Intergenic
1116124019 14:40758325-40758347 CTGGGTCATTGCTATCATTTGGG - Intergenic
1117220580 14:53600714-53600736 CAGACTCAAGGCTAGCATTTGGG - Intergenic
1117357587 14:54940198-54940220 GTGAATGAAGGCTAGAATTTGGG + Exonic
1117918907 14:60707210-60707232 CTGGGTTAAGTCTTGAATTCTGG + Intergenic
1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG + Intronic
1120761373 14:88288662-88288684 GTGGGCCATGGCCAGAATTTGGG - Intronic
1122309162 14:100783674-100783696 CTGTGCCAGGGCTAGGATTTCGG + Intergenic
1124573528 15:30887096-30887118 CTGGGTCATGGGTAGAGATTGGG - Intergenic
1128087838 15:64897997-64898019 CTGGGTCAAGGGTAGAAGCAGGG - Intronic
1129031758 15:72623824-72623846 GTGTGTCAAGGCTACATTTTAGG - Intergenic
1129735294 15:77957686-77957708 GTGTGTCAAGGCTACATTTTAGG + Intergenic
1134657113 16:15955410-15955432 CTGGGCCAAGACTAGACTGTAGG - Intronic
1138578780 16:57926139-57926161 CTGGGGAAAGGGTGGAATTTGGG - Intronic
1142884057 17:2901905-2901927 CTAGGCCAAGGCTAGAACCTGGG + Intronic
1146472189 17:33133433-33133455 CTGGGTAAAGGCCAGATGTTAGG + Intronic
1150145086 17:62762113-62762135 CTGGGGCAAGCCAAGAATTCCGG - Intronic
1150422026 17:65045419-65045441 CTGGGTCAGGGCTTGAACCTGGG + Intronic
1154164502 18:12004415-12004437 CTGGATTAAGGCTAAAAGTTTGG - Intronic
1155615204 18:27714277-27714299 CTAGGTCAAGGCTATAAGGTTGG - Intergenic
1156550550 18:38011906-38011928 CTTGGTCAAGGATAAAATTATGG - Intergenic
1157765355 18:50292516-50292538 CTGGGTCAAGACTGGACCTTGGG + Intergenic
1157911224 18:51619055-51619077 CTGGTTCAAAGCTAGGAATTGGG - Intergenic
1161031058 19:2057943-2057965 CGGGGTCAAAGCCAGAAATTGGG - Intergenic
1161954131 19:7483394-7483416 CAGGGTCCAGGCTAGACTCTGGG + Intronic
1165649329 19:37471785-37471807 ATGGGACAAGGATAGAATTAGGG + Intronic
1166705242 19:44904836-44904858 CTGGGTTAAGGTTAGGATTCTGG - Intergenic
926840391 2:17073328-17073350 CTGGGTAATGGGTAGAATATGGG + Intergenic
927819999 2:26255896-26255918 CTGGGTCAACATTAGAATTAGGG - Intronic
929383463 2:41379568-41379590 CTGGGGAAAGGGTAGAAGTTAGG - Intergenic
936573095 2:113632756-113632778 CCGGGTCAAGTCTGGAAATTGGG - Intronic
936819349 2:116499997-116500019 CTGGCTCAAGGCAAGAATTCAGG - Intergenic
939797201 2:146660084-146660106 CTTGGTCAAATCTAGAAATTAGG - Intergenic
941006006 2:160247743-160247765 CTGGTTCAAGGCTGGCTTTTGGG - Intronic
942007794 2:171724349-171724371 CTGGGTAAAGGCTTGTCTTTAGG + Intronic
942420852 2:175806049-175806071 CTGGCTCTAGGCTAGGATGTAGG - Intergenic
944016981 2:195052386-195052408 CAGGGTTAAGGTTAGAAATTTGG - Intergenic
944521165 2:200568642-200568664 TTGGTTCAAGGTTAGAATTCAGG - Intronic
947583287 2:231335259-231335281 CTGGGTTAAGGATAGAGTCTAGG + Intronic
949050298 2:241894340-241894362 CTGGGGCAGGGCGATAATTTCGG + Intronic
1169921153 20:10735556-10735578 CTGGGTCTAGGTTTGAATTTTGG + Intergenic
1173914930 20:46700344-46700366 ATGGTTCAAGCCTAGTATTTGGG + Intergenic
1182787564 22:32920345-32920367 GTGGGGCCAGGCTAGAATTTGGG + Intronic
1183407508 22:37637771-37637793 CTGGGTGATGGGTAGATTTTAGG - Intronic
1183479544 22:38056071-38056093 CTGTTTCCAGGCCAGAATTTTGG - Intergenic
1185427090 22:50778118-50778140 CCGGGTCAAGTCTGGAAGTTGGG + Intronic
950437466 3:12989001-12989023 CAGGGCCAAGACTAGAATCTAGG + Intronic
952897262 3:38085888-38085910 CTGGGCATAGGCTGGAATTTGGG + Intronic
957281209 3:78153946-78153968 CTTGGTCCATGCTAGAATCTGGG - Intergenic
959005349 3:101013524-101013546 AGGGGTCAAGGCCAGAATATGGG - Intergenic
962751446 3:138437093-138437115 CTGGGTCAAGCCTGGGATATGGG - Intronic
964590067 3:158351573-158351595 CTGGGTCAAGTGTATTATTTTGG + Intronic
964787416 3:160413303-160413325 CTGGGTCAAGGCTAGAATTTAGG - Intronic
969097783 4:4747033-4747055 GTGAGTCAAGGCAAGAACTTGGG - Intergenic
973198449 4:47472787-47472809 TTTGGTCAAGGATAAAATTTTGG - Intergenic
975658305 4:76663453-76663475 CTAAGTCAAGGCTAGAATCCAGG + Intronic
976865228 4:89717634-89717656 GTGAGTCAAGGCTGAAATTTTGG + Intergenic
981822273 4:148899764-148899786 TTGGTTCAAGCCTTGAATTTTGG + Intergenic
985662198 5:1162801-1162823 TTGGGCCTAGGGTAGAATTTGGG + Intergenic
986502545 5:8415728-8415750 CTGGGGAAAGGTTAGAAGTTAGG - Intergenic
987660896 5:20874209-20874231 CTGGGTCAAGTGTTGAGTTTAGG - Intergenic
989590302 5:43106476-43106498 CAGGGCCAAGACAAGAATTTGGG + Intronic
992406062 5:76459040-76459062 CTGGGTCAAGCCTGGAAGATAGG + Intronic
993844366 5:92922229-92922251 CTGGATCTAGTCAAGAATTTGGG - Intergenic
994269775 5:97763125-97763147 CTGGGTCAAGTCTGGAACTTAGG - Intergenic
999177304 5:149640440-149640462 CTGGGGCAGGGCTGGAATTGGGG + Intergenic
999487414 5:152012086-152012108 CTGGGACAGGGCTAGACATTAGG - Intergenic
1000001782 5:157145346-157145368 CAGAATCAAGGCTAGAATCTTGG + Intronic
1001354562 5:171007095-171007117 CTGGGGAAAGGGTAGAAGTTAGG + Intronic
1002411420 5:179081010-179081032 CAGAGTCAAGACTAGAATCTAGG + Exonic
1003452601 6:6249698-6249720 CAGGCTAAAGGCTAGAAATTGGG + Intronic
1003627848 6:7759556-7759578 CAGGTTCAAGGCAAGAGTTTAGG - Intronic
1004061869 6:12205545-12205567 CTTGGGCAAGGCTACTATTTTGG + Intergenic
1006685967 6:35834293-35834315 CTGCTTCAAGGCCAGAATTTTGG + Exonic
1007807953 6:44464735-44464757 CTGGGTCAAGGGCAGAGTCTGGG - Intergenic
1007919935 6:45597819-45597841 CTGAGTCAAGGCTAGACTGAAGG + Intronic
1010096089 6:72048215-72048237 CTGGTTCAGGGCTAGATTTTTGG - Intronic
1010859174 6:80884713-80884735 TTGGGACAAGGCTAAAATGTGGG - Intergenic
1013752381 6:113422345-113422367 CAGGGTCAAGACTAGAATGCTGG + Intergenic
1015456210 6:133429417-133429439 ATGGGTCAAGGGAAGAATTAAGG + Intronic
1019909750 7:4092619-4092641 CTGGCCCTGGGCTAGAATTTGGG + Intronic
1026077275 7:67183738-67183760 CTGGGTAAATGATATAATTTTGG - Intronic
1026699594 7:72628363-72628385 CTGGGTAAATGATATAATTTTGG + Intronic
1026946742 7:74321017-74321039 CTGGATCACAGCCAGAATTTGGG - Intronic
1028296184 7:89134622-89134644 CTGAGTCAAGGCAGGAAATTGGG - Intronic
1030084751 7:105806642-105806664 CAGGGTTAAGGCTAGAATTTGGG + Intronic
1037506802 8:19538767-19538789 CTGGGTCAAGGTTATAAAGTAGG + Intronic
1038041819 8:23729664-23729686 CTAAGTCAAGATTAGAATTTAGG - Intergenic
1038501910 8:28051964-28051986 CTGGGTCAAGGCAAAATTTAAGG + Intronic
1039152655 8:34524464-34524486 CAGGGTAAAGGATAGGATTTAGG - Intergenic
1039350007 8:36753699-36753721 CTGGTTCATGGATAAAATTTTGG + Intergenic
1040283751 8:46089108-46089130 CTGGGTCAGGGCTAGAGTCCAGG + Intergenic
1041224486 8:55685066-55685088 CTGGGTCAAAGCTGGAAATGGGG + Intergenic
1044744636 8:95360587-95360609 CTGGGGCAAGACTAGAATTTAGG + Intergenic
1046860800 8:119089256-119089278 CTAGGTCATGCCTACAATTTTGG + Intronic
1047989791 8:130273989-130274011 CTGAGCCAAGGCTAGAACTCAGG - Intronic
1048494136 8:134921261-134921283 CTGGGTCAGGGCTGGAACCTGGG + Intergenic
1049329568 8:142043044-142043066 TTGGGTCAAGGTTGGATTTTGGG + Intergenic
1051332635 9:16039284-16039306 CTGAGTCAAGGCTGGAATAGGGG - Intronic
1051592329 9:18788961-18788983 CTGAGTCAAGAATAGAATTAAGG + Intronic
1053138016 9:35663899-35663921 CAGGGTCGAGGCAAGAGTTTGGG + Intronic
1055186083 9:73455625-73455647 CTGGGTCCTGGCTAGAATCTTGG + Intergenic
1056621550 9:88219057-88219079 CTGGCTCACGGTGAGAATTTAGG - Intergenic
1058331495 9:103766825-103766847 CTGGGTAATGGGTTGAATTTCGG + Intergenic
1060282406 9:122223230-122223252 CTGGGTTGAGGGTAGAATTGTGG - Intronic
1060616859 9:125024608-125024630 GTTGGACAAGGCTAGAATTCTGG - Intronic
1062217897 9:135399076-135399098 CAGGGTCCAGGCTAGAGTTGGGG + Intergenic
1062739271 9:138159070-138159092 CTGGGTCAAGGTCAGGGTTTAGG + Intergenic
1188624612 X:32268268-32268290 CTGCGTCAAAGATAGACTTTAGG - Intronic
1189108183 X:38257969-38257991 CTAGGTCAAGGCTAGTCTTTTGG - Intronic
1189146747 X:38662908-38662930 CTTGGTCAAGGTTAGAATGTTGG + Intronic
1192890280 X:75383390-75383412 CTGGCTCAAGTAAAGAATTTGGG - Intronic
1194319848 X:92431701-92431723 TAGGATCAAGGCAAGAATTTCGG + Intronic
1196581372 X:117383058-117383080 TTGGGTTAAGCCTATAATTTTGG - Intergenic
1198969171 X:142261620-142261642 ATGGTTCAGGGCCAGAATTTTGG + Intergenic
1200627974 Y:5544834-5544856 TAGGATCAAGGCAAGAATTTCGG + Intronic
1200692378 Y:6319391-6319413 CTGGGTCCAGGGTATAACTTTGG + Intergenic
1200812760 Y:7502360-7502382 CTGGGGAAAGGGTAGAAGTTAGG - Intergenic
1201042894 Y:9855336-9855358 CTGGGTCCAGGGTATAACTTTGG - Intergenic
1202162958 Y:21954568-21954590 CTGGGTCCAGGGTATAATTTTGG + Intergenic
1202228398 Y:22631800-22631822 CTGGGTCCAGGGTATAATTTTGG - Intergenic
1202314759 Y:23564376-23564398 CTGGGTCCAGGGTATAATTTTGG + Intergenic
1202556042 Y:26106217-26106239 CTGGGTCCAGGGTATAATTTTGG - Intergenic