ID: 964790000

View in Genome Browser
Species Human (GRCh38)
Location 3:160445169-160445191
Sequence CTGTGGAAGGCCAAGGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265827
Summary {0: 8, 1: 1133, 2: 25627, 3: 79568, 4: 159491}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964789991_964790000 11 Left 964789991 3:160445135-160445157 CCTGGTGTAATGGCTCATACCTG 0: 5
1: 105
2: 2569
3: 30831
4: 95228
Right 964790000 3:160445169-160445191 CTGTGGAAGGCCAAGGTGGGAGG 0: 8
1: 1133
2: 25627
3: 79568
4: 159491
964789993_964790000 -8 Left 964789993 3:160445154-160445176 CCTGTAATCCCAGCACTGTGGAA 0: 88
1: 12765
2: 310723
3: 261915
4: 145751
Right 964790000 3:160445169-160445191 CTGTGGAAGGCCAAGGTGGGAGG 0: 8
1: 1133
2: 25627
3: 79568
4: 159491

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964790000 Original CRISPR CTGTGGAAGGCCAAGGTGGG AGG Intronic
Too many off-targets to display for this crispr