ID: 964790464

View in Genome Browser
Species Human (GRCh38)
Location 3:160449804-160449826
Sequence CCTTCGGGGCAGAGGAGGGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 464
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 430}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964790464_964790477 1 Left 964790464 3:160449804-160449826 CCCGCCCTCCTCTGCCCCGAAGG 0: 1
1: 0
2: 1
3: 32
4: 430
Right 964790477 3:160449828-160449850 CTTCAGGTGCCCAGACCGGGCGG 0: 1
1: 0
2: 0
3: 13
4: 173
964790464_964790479 3 Left 964790464 3:160449804-160449826 CCCGCCCTCCTCTGCCCCGAAGG 0: 1
1: 0
2: 1
3: 32
4: 430
Right 964790479 3:160449830-160449852 TCAGGTGCCCAGACCGGGCGGGG 0: 1
1: 0
2: 2
3: 17
4: 181
964790464_964790475 -3 Left 964790464 3:160449804-160449826 CCCGCCCTCCTCTGCCCCGAAGG 0: 1
1: 0
2: 1
3: 32
4: 430
Right 964790475 3:160449824-160449846 AGGGCTTCAGGTGCCCAGACCGG 0: 1
1: 0
2: 0
3: 21
4: 239
964790464_964790485 27 Left 964790464 3:160449804-160449826 CCCGCCCTCCTCTGCCCCGAAGG 0: 1
1: 0
2: 1
3: 32
4: 430
Right 964790485 3:160449854-160449876 CTCGCGGAGCCTCGCAGCGCAGG 0: 1
1: 0
2: 0
3: 9
4: 58
964790464_964790476 -2 Left 964790464 3:160449804-160449826 CCCGCCCTCCTCTGCCCCGAAGG 0: 1
1: 0
2: 1
3: 32
4: 430
Right 964790476 3:160449825-160449847 GGGCTTCAGGTGCCCAGACCGGG 0: 1
1: 0
2: 3
3: 19
4: 274
964790464_964790482 11 Left 964790464 3:160449804-160449826 CCCGCCCTCCTCTGCCCCGAAGG 0: 1
1: 0
2: 1
3: 32
4: 430
Right 964790482 3:160449838-160449860 CCAGACCGGGCGGGGCCTCGCGG 0: 1
1: 0
2: 0
3: 19
4: 221
964790464_964790478 2 Left 964790464 3:160449804-160449826 CCCGCCCTCCTCTGCCCCGAAGG 0: 1
1: 0
2: 1
3: 32
4: 430
Right 964790478 3:160449829-160449851 TTCAGGTGCCCAGACCGGGCGGG 0: 1
1: 1
2: 2
3: 14
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964790464 Original CRISPR CCTTCGGGGCAGAGGAGGGC GGG (reversed) Exonic
900074041 1:797788-797810 ACCTCGGGGCAGCGGTGGGCGGG - Intergenic
900478912 1:2888945-2888967 CCTCCAGGGCAGAGGACGGTGGG - Intergenic
900548654 1:3242531-3242553 CCTGCGGGGCCGAGGCGTGCTGG - Intronic
900560755 1:3304904-3304926 CCTGGGTGGCAGCGGAGGGCAGG - Intronic
900713304 1:4128710-4128732 CCTCAGGGGCACAGGAGGGAAGG - Intergenic
900979749 1:6039604-6039626 GCATTGGGGCAGAGCAGGGCTGG + Intronic
901639671 1:10686902-10686924 CCTGCCGGGCAGTGGAGAGCCGG + Intronic
902549315 1:17209960-17209982 CTTGGGGGGCAGAGGAGTGCAGG - Intronic
902580434 1:17404373-17404395 TGTTCGGGGCAAAGCAGGGCTGG + Intergenic
903447368 1:23431044-23431066 CCTTCTGGGCAGAGGCTGCCTGG + Exonic
903455739 1:23485080-23485102 CCTTTGGGGCGGATGAGGGATGG + Intergenic
904494584 1:30879480-30879502 CTTTCTGGGCAGAGGGGAGCTGG - Intronic
904575708 1:31503917-31503939 CCTGCAGGGCAGGGAAGGGCAGG - Intergenic
904641937 1:31937921-31937943 GCCTCGGGGAAGGGGAGGGCGGG - Intronic
904941617 1:34167494-34167516 CCCTGGGGGCTGTGGAGGGCAGG + Intronic
904978196 1:34474580-34474602 GCTTCAGGGCACAGCAGGGCAGG + Intergenic
905172333 1:36116517-36116539 CCTTCAGGGCAAGGCAGGGCAGG - Intronic
905217331 1:36418107-36418129 CCCTGGGGGCAGAGGACGCCTGG + Exonic
905220239 1:36441127-36441149 CCTGCTGGGAAGAGGACGGCGGG + Intronic
905242556 1:36590214-36590236 ACTCCGGGGGACAGGAGGGCTGG - Intergenic
905775751 1:40666012-40666034 GCTTCAGGGCAGGGCAGGGCAGG - Intergenic
905819534 1:40979236-40979258 CCTTCGGGGCAGGTGTGGGGAGG + Intergenic
905823960 1:41015506-41015528 CCTCCTGGACAGAGGTGGGCTGG + Intergenic
906251233 1:44312408-44312430 CCTCCAGGCCAGAGGAGGGTGGG + Intronic
907801387 1:57769271-57769293 CAATGGGGGCAGAGGAGGACAGG - Intronic
910806462 1:91193555-91193577 CCTGGGGGGTAGAGGAGGGGTGG - Intergenic
910981768 1:92965286-92965308 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
911205774 1:95090357-95090379 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
912490588 1:110060652-110060674 GCTTGGAGGCAGAGGTGGGCTGG + Exonic
913205502 1:116534567-116534589 CCTTCAGGGCAGTGGGCGGCAGG + Intronic
913253902 1:116937172-116937194 CCTTGGGAGCAGAGCATGGCTGG + Intronic
913957596 1:143319183-143319205 GCACCAGGGCAGAGGAGGGCAGG + Intergenic
914051907 1:144144547-144144569 GCACCAGGGCAGAGGAGGGCAGG + Intergenic
914127290 1:144821994-144822016 GCACCAGGGCAGAGGAGGGCAGG - Intergenic
916074170 1:161190869-161190891 CCTGCGGGTCACAGGAGGGAGGG - Exonic
916123395 1:161549112-161549134 CTCCTGGGGCAGAGGAGGGCAGG - Intronic
916133287 1:161630470-161630492 CTCCTGGGGCAGAGGAGGGCAGG - Intronic
916651792 1:166839979-166840001 GCTCCGGGGCAGAGGTGGGAGGG - Intronic
917974432 1:180230012-180230034 CCGGCGGGGCGGAGGGGGGCGGG - Intergenic
918236795 1:182589024-182589046 CCTTCCGGGCAGCCAAGGGCTGG + Intronic
918311434 1:183288225-183288247 CCATGGGGGCTGACGAGGGCAGG - Intronic
918338316 1:183544471-183544493 CCTGCTGGGAAGAGGAGGGAAGG - Exonic
920091339 1:203455286-203455308 CCTCAGAGGCAGATGAGGGCTGG - Intergenic
920300503 1:204985888-204985910 CCTTCGGGACAGAGGCAGGCTGG - Intronic
920951451 1:210575105-210575127 CCTTAGGGGCAAGGGAGGGTGGG + Intronic
921308632 1:213821347-213821369 CCCTGGGGGAAAAGGAGGGCTGG - Intergenic
921674964 1:217966607-217966629 AATTCTGGGCAGAGGAGGGTGGG - Intergenic
922269894 1:224022693-224022715 ACCTCGGGGCAGCGGTGGGCGGG - Intergenic
922364854 1:224854182-224854204 CCATGGGGGCTGAGGAGGGAGGG + Intergenic
922821327 1:228487601-228487623 GCTTCTGGGCCGAGGAGGACGGG + Exonic
923086290 1:230705818-230705840 CCTTGGGTGCAGAGCAGGGCAGG - Intronic
923558951 1:235023768-235023790 CCTTCGGGGGAGGGGTGGGAGGG + Intergenic
923954353 1:238997929-238997951 CCTTGGGGGGAGAGGTGGGAGGG - Intergenic
1063374686 10:5547078-5547100 CCTTCTGGGCAGGTGCGGGCTGG + Intergenic
1065656571 10:27957362-27957384 CCATCGGGGCAGAGGTAGGGAGG + Intronic
1065917438 10:30365294-30365316 GGTTGGGGGCAGAGCAGGGCAGG - Intronic
1066961544 10:42231368-42231390 GCACCAGGGCAGAGGAGGGCAGG + Intergenic
1066994678 10:42552725-42552747 GCTTCGGGGCAGAGGATGCCGGG - Intergenic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1069521550 10:69124963-69124985 CCTATGAGGCAGAGGAGGGAGGG + Intronic
1071974343 10:90939998-90940020 CCTGTGGAGCAGAGGTGGGCGGG + Intergenic
1075006706 10:118835864-118835886 CCTTTGGGGAAGAGGTGGGGAGG - Intergenic
1075795565 10:125117149-125117171 GAGTCGGGGCAGAGGAGGGTTGG - Intronic
1075799659 10:125145485-125145507 CCCTTGGGGCAGGGTAGGGCAGG + Intronic
1075859975 10:125667029-125667051 CCTTCAGGGCAGAGGCCTGCAGG + Intronic
1076177700 10:128381108-128381130 CTCAGGGGGCAGAGGAGGGCAGG - Intergenic
1076206876 10:128610769-128610791 CCTGCAGGGCAGACCAGGGCAGG - Intergenic
1076323688 10:129603936-129603958 CCTCCTGAGCAGTGGAGGGCTGG + Intronic
1076481456 10:130787829-130787851 CCTTCAGGGGGGAGGTGGGCAGG - Intergenic
1076739738 10:132477379-132477401 CCTCTGGGTCAGGGGAGGGCAGG - Intergenic
1076798797 10:132811306-132811328 CCTCCAGGGCAGAGGAGGCTGGG - Intronic
1076872325 10:133200132-133200154 GCTGCGGGGCCGAGGAGGCCGGG - Intronic
1077393066 11:2308715-2308737 CCCTGGGGGCAGAGCGGGGCTGG - Exonic
1077520774 11:3032555-3032577 TTGTCGGGGCAGAGGTGGGCTGG + Intronic
1079240853 11:18721298-18721320 CCCCCGGGGCAGAGCAGAGCAGG - Intronic
1079608990 11:22406794-22406816 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1080204447 11:29712878-29712900 CCTGCAGGGCAGGGCAGGGCTGG + Intergenic
1080503585 11:32892568-32892590 CCTTCCGGGCTGCGGAAGGCGGG + Intergenic
1081534397 11:43986700-43986722 CCTTTGGTGGAGAGAAGGGCTGG - Intergenic
1082005176 11:47415202-47415224 CCTTAGGGGCTCAGGAGGGAAGG + Intronic
1082806351 11:57454128-57454150 CCTTGGGGGCAGAGGTTGCCCGG - Intergenic
1084192033 11:67503792-67503814 CCTCCGCGGCAGAGGAAGGCGGG - Intronic
1084207660 11:67605363-67605385 CCTTTGGGGCAGAAGAAGGGGGG - Intronic
1084569993 11:69953571-69953593 TCTCCGGGGCAGAGGAGAGGCGG + Intergenic
1084704915 11:70810540-70810562 CACTCGGGGCAGATGTGGGCAGG - Intronic
1084768352 11:71326733-71326755 CCGACTGGCCAGAGGAGGGCTGG - Intergenic
1085322635 11:75583998-75584020 CTTTCTGGGTAGTGGAGGGCTGG + Intergenic
1087013382 11:93533782-93533804 CTGTCGGGGCAGATGAGGGTGGG - Intronic
1088568406 11:111197305-111197327 CTTTCTGGGCAGAGCAGGTCCGG + Intergenic
1088695459 11:112362372-112362394 TCTTCGGGGAAGAGCATGGCAGG + Intergenic
1089630666 11:119782267-119782289 CCCTCGGGGCAGAGGTGAGCAGG - Intergenic
1089713606 11:120336106-120336128 CCTACGGGGCAGAGGGAGGTGGG - Intergenic
1090178685 11:124674147-124674169 CAATGTGGGCAGAGGAGGGCGGG - Exonic
1090187581 11:124748373-124748395 CCTTCGGTGAGCAGGAGGGCTGG - Exonic
1090441539 11:126728937-126728959 CTTTCGGGGCAGAGGGAGGAGGG + Intronic
1090914436 11:131150684-131150706 GCTGTGGGGCAGAGGAGAGCTGG + Intergenic
1091046135 11:132327590-132327612 TCTAGTGGGCAGAGGAGGGCTGG - Intronic
1091302251 11:134515111-134515133 CGTGCGGGGCAGAGGCGGGAGGG - Intergenic
1091801286 12:3326311-3326333 CCAACTGGGAAGAGGAGGGCAGG - Intergenic
1092217519 12:6693661-6693683 GCTCCAGGTCAGAGGAGGGCAGG + Intergenic
1092258927 12:6942081-6942103 CCAACGGGGCAGGGGAGGGGCGG - Exonic
1093401772 12:18754483-18754505 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
1093878506 12:24377016-24377038 CGTTTAGGGCAGAGGATGGCTGG - Intergenic
1093878659 12:24378894-24378916 GGTTTGGGGCAGAGGATGGCTGG - Intergenic
1097069228 12:56342755-56342777 GCTTAGGGGCAGAGTAGGGGAGG + Exonic
1097679061 12:62632250-62632272 CCTTGAGGGCAGAGGAGCGTGGG + Intergenic
1099222859 12:79935029-79935051 AGTGCGGGCCAGAGGAGGGCTGG + Exonic
1101321765 12:103678945-103678967 CCTGCGGGCCAGTGCAGGGCTGG + Intronic
1101330415 12:103753332-103753354 CCTTCTGGGCATAGGAGAGCTGG - Exonic
1101966911 12:109287909-109287931 CCTGCAGGCCAGATGAGGGCTGG + Exonic
1102235432 12:111291531-111291553 CCTTTGGGGCTGAGGAGCTCGGG - Exonic
1102342991 12:112138305-112138327 TTTTGGAGGCAGAGGAGGGCGGG + Intronic
1103377804 12:120470021-120470043 CCTGCGGGGCGCAGGAGAGCTGG + Exonic
1103867143 12:124062316-124062338 ACTTGGGGGCAGAAGAGGGAAGG - Intronic
1104924970 12:132309247-132309269 CATGCGGGGCAGAGATGGGCTGG + Intronic
1105851607 13:24340515-24340537 CCTTCGGGGCAGTCGGGCGCAGG - Intergenic
1107881554 13:44836759-44836781 CCTTGGGGGCAGGGAAGGCCAGG - Intergenic
1108418116 13:50221595-50221617 CCTTTGGTGAAGAGGAGGGATGG + Intronic
1108487635 13:50942970-50942992 AATTCTGGGCAGAAGAGGGCCGG - Intronic
1112621910 13:101061909-101061931 CCTGCGGGGCAGGGCGGGGCGGG + Intronic
1113010642 13:105761857-105761879 CCTTCTGGGCTGAGGAGAGCTGG + Intergenic
1113378485 13:109784268-109784290 CCAGCGAGGCAGAGGAGGGCTGG + Exonic
1113814912 13:113163131-113163153 CCTTGGGGGAAGGGGACGGCCGG - Intronic
1114470307 14:22956866-22956888 GCTTCGGGGAAGAGGAGCTCTGG - Intronic
1114665391 14:24374474-24374496 CCTGCTGGGGAGGGGAGGGCAGG + Intronic
1115015508 14:28607686-28607708 CCTTCTGGCCAGAAGAGGGTTGG - Intergenic
1116618470 14:47168135-47168157 CCTTCATGGCAGAGAAGGGAAGG - Intronic
1117221265 14:53608883-53608905 CCATCTGGGCAGAGAAAGGCTGG - Intergenic
1117424333 14:55579935-55579957 CCTTCGGGACAGGGGAGAGCGGG + Intronic
1117892103 14:60435707-60435729 CCTTCTGGGGAGAGCGGGGCAGG + Intronic
1119430901 14:74567451-74567473 CCTCAGGGGCAGAGGCGGGGTGG + Intronic
1120255186 14:82109916-82109938 CTTTCGGGGGAGAGCAGGGCAGG + Intergenic
1121017753 14:90558693-90558715 CCGGCAGGGCAGAGGAGCGCTGG - Intronic
1121324407 14:93011640-93011662 CCTTCATGGCAGCGGAGGGAGGG + Intronic
1121867057 14:97372437-97372459 CCAACTGGGCAGAGGAGAGCAGG - Intergenic
1122429838 14:101633349-101633371 CCTTCGGGGAAGATGCGGGAGGG + Intergenic
1122643278 14:103175050-103175072 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1123018638 14:105387300-105387322 CATTCTCGGCAGAGGAGGGCGGG - Intronic
1123024966 14:105420133-105420155 CCTGCGGGGCAGAGGGGCGGGGG - Intronic
1202930785 14_KI270725v1_random:30907-30929 GCACCAGGGCAGAGGAGGGCAGG - Intergenic
1123443482 15:20306010-20306032 GCGCCAGGGCAGAGGAGGGCAGG - Intergenic
1125267900 15:37904768-37904790 CCTCCAGGACAGAGGAGGGAAGG - Intergenic
1125506753 15:40271764-40271786 CCATGGGGGCAGAAGAGGCCTGG - Intronic
1125715862 15:41819604-41819626 GCTTCGGGGCAAAGCTGGGCTGG - Exonic
1127345695 15:58095676-58095698 CCTTCCTGTCAGAGCAGGGCAGG - Intronic
1127843131 15:62847327-62847349 GCTCCGGGGCAGAGATGGGCTGG + Intergenic
1127964184 15:63911760-63911782 CCTTCAGGGAAGAGGAGGACTGG + Intronic
1127994192 15:64143105-64143127 CCTAGGGGGAAGGGGAGGGCGGG + Intronic
1128793149 15:70447878-70447900 CCTGAGGGTCAGAGGAGGCCTGG - Intergenic
1128978179 15:72168160-72168182 CCCTTGGGGCAGAGCAGAGCAGG - Intronic
1129190037 15:73931760-73931782 CCTGGAGGGCAGAGGTGGGCAGG - Intronic
1129854051 15:78811563-78811585 CCTGCGGGGCCGATGAGGCCGGG - Intronic
1129897232 15:79117542-79117564 CCTTTTGGGCAGTGGAGTGCAGG - Intergenic
1130088966 15:80803219-80803241 CCTTGGGGCCACAGGATGGCTGG + Intronic
1130402987 15:83574398-83574420 CCTGCGGCCCAGAGGAGGACTGG - Intronic
1131714812 15:95096853-95096875 CCGTCCGCGGAGAGGAGGGCTGG - Intergenic
1132040754 15:98523053-98523075 CCTGGGGGGCTGAGGAGGGAGGG - Intergenic
1132705760 16:1242474-1242496 CTATCTGGGCAGGGGAGGGCTGG - Exonic
1133227069 16:4346123-4346145 GCTGCAGGGCAGAGGGGGGCTGG + Intronic
1134102240 16:11460634-11460656 GCTGCCTGGCAGAGGAGGGCAGG - Intronic
1135057105 16:19240688-19240710 GCTTCTGGGCAGAAGAGGGCTGG - Intronic
1136139274 16:28278248-28278270 ACTTTGGGGCAGGGGAGAGCAGG + Intergenic
1136409864 16:30069945-30069967 CCTTCAGGGCAGAGGCCTGCAGG - Exonic
1137024942 16:35464398-35464420 CCTTGGGGGCACAGGTGGGGTGG + Intergenic
1138079106 16:54071940-54071962 CGTTAGGGGCAAAGGAAGGCCGG + Intronic
1138415367 16:56868382-56868404 CCTCTGGGGAAGAGGAGGGAGGG + Intronic
1140805773 16:78530703-78530725 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1141153321 16:81579612-81579634 CCTTCAGGGGGGAGCAGGGCTGG - Intronic
1141605636 16:85151907-85151929 CCAGCCGGGGAGAGGAGGGCGGG - Intergenic
1141716464 16:85729838-85729860 CCTTTGGCGCTGAGGAGGGAGGG + Intronic
1142209801 16:88803697-88803719 CCATCGGGGCAGAGCACGGGGGG - Exonic
1142338829 16:89507942-89507964 CCTTCGGGTGTGAGGAGCGCAGG - Intronic
1142640207 17:1281021-1281043 TCTTCAGGGCAGGGGAGGTCTGG + Intronic
1142885961 17:2912218-2912240 CCCTCTGGGCAGAGCTGGGCTGG + Intronic
1143140474 17:4739493-4739515 CGGTCGGGGCACAGCAGGGCCGG - Exonic
1143447947 17:7019841-7019863 GCATCGGGACAGAGCAGGGCTGG - Intergenic
1143515333 17:7416905-7416927 CCCTGTGGGCACAGGAGGGCAGG - Exonic
1143539249 17:7559539-7559561 TCTCGGGGGCAGGGGAGGGCTGG + Intronic
1143729521 17:8873143-8873165 CCTCTGGGGAAGAGGAGGGAGGG - Intergenic
1144666488 17:17105593-17105615 CCACTGAGGCAGAGGAGGGCAGG + Intronic
1144950680 17:18991964-18991986 CCTGGGGGGCAGAGGCAGGCAGG + Intronic
1145052839 17:19677107-19677129 CCTGCTGGACAGAGCAGGGCAGG + Exonic
1145921655 17:28614323-28614345 GCTTCAGGGCAGAGGAAGGAAGG + Intergenic
1147230122 17:39011651-39011673 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1147644430 17:42025363-42025385 CTTTCGGGGCTCAGGAGGGTGGG + Exonic
1148074442 17:44927412-44927434 CCTGTGGGGCAGAGGCTGGCAGG - Intronic
1148091101 17:45022912-45022934 CCTAAGGGGCAAAGAAGGGCCGG - Intergenic
1148865754 17:50627725-50627747 CCTTCACGGCTGGGGAGGGCAGG - Intergenic
1148866047 17:50629244-50629266 CCTACTGGGAAGAGGAGGCCAGG - Intergenic
1148867142 17:50634720-50634742 ACTTTGGGGCAGAGGTGGGGGGG - Intergenic
1148910664 17:50940676-50940698 CCTGCTGGGCAGAGCAGGCCGGG - Intergenic
1150133607 17:62682184-62682206 CCCCCAGGGCAGAGCAGGGCAGG - Intronic
1150303181 17:64063178-64063200 CAGTAGGGGCAGAGCAGGGCAGG - Intronic
1150489045 17:65561778-65561800 CCCTCGGGGCCGCGGGGGGCTGG - Intronic
1151828624 17:76537329-76537351 GGCTCCGGGCAGAGGAGGGCTGG - Intronic
1152361693 17:79835890-79835912 CCTCTTGGGCAGAGGAGGGTTGG - Intronic
1152478365 17:80533237-80533259 CCTTCAGGGCCCAGGTGGGCTGG + Intergenic
1152659983 17:81537594-81537616 CCTTAGGGACAAAGAAGGGCAGG + Intergenic
1152760762 17:82105959-82105981 CCTTTGGAGCAGAGGAGAGGTGG + Intronic
1152925010 17:83083177-83083199 CCTCCTGGGCAGAGGTGGGTTGG + Intronic
1153512858 18:5874270-5874292 TCTTGGGGGCATGGGAGGGCAGG - Intergenic
1156036578 18:32771971-32771993 GCATCTAGGCAGAGGAGGGCAGG + Intronic
1157913458 18:51641016-51641038 CCTTGGGGGGGCAGGAGGGCAGG - Intergenic
1158341320 18:56469718-56469740 CAATGGGTGCAGAGGAGGGCGGG - Intergenic
1160345705 18:78130018-78130040 CCCTCGGGACAGAACAGGGCAGG + Intergenic
1160856216 19:1219112-1219134 CCTACGGGGAAGGGGAGGACAGG - Intronic
1160952713 19:1675385-1675407 CCTTTGGGGAACAGGTGGGCAGG + Intergenic
1161175846 19:2841777-2841799 CCTTGGGGCCAGAGGCGGGCGGG - Intronic
1161226494 19:3148864-3148886 ACTTCAGGGCAGGGCAGGGCAGG + Intronic
1162109857 19:8394095-8394117 CCAGCGGGGCAGTGGCGGGCTGG - Intronic
1162342371 19:10099210-10099232 GATTCAGGGCAGAGGAGGGAGGG - Intronic
1162760931 19:12887695-12887717 CCTCCGGTGAAGGGGAGGGCTGG + Intergenic
1162881805 19:13665379-13665401 CCATCAGGGCAGAGTAGGGAGGG + Intergenic
1162955865 19:14097544-14097566 CCTCAGGGGAAGGGGAGGGCTGG + Intronic
1163496154 19:17647707-17647729 GGTGCGGGGCAGAGAAGGGCAGG - Intronic
1163578577 19:18124621-18124643 TCCTAGGGGCACAGGAGGGCTGG - Exonic
1164048023 19:21559492-21559514 CTTTGGAGGCAGAGGTGGGCGGG - Intergenic
1164402403 19:27911072-27911094 CCTAGGGGGCACAGGAGGGTTGG + Intergenic
1166356464 19:42230313-42230335 CCTTGGGGGCAGAGGACAGGAGG + Exonic
1166376613 19:42331001-42331023 GCTTTGGGGCAGGGGAGGGACGG + Intronic
1166377599 19:42336329-42336351 CTTACCGGGCAGTGGAGGGCCGG - Exonic
1166897457 19:46032840-46032862 CCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1167250353 19:48395830-48395852 CCTTGGGGGAAGAGGGGAGCTGG + Intronic
1167361587 19:49033128-49033150 CCTTTGAGGAAGAGGAGGCCTGG - Exonic
1167365766 19:49054362-49054384 CCTTTGAGGAAGAGGAGGCCTGG + Exonic
1168050159 19:53823965-53823987 ACTTCGGGCCAGAGGAGGCCTGG - Exonic
1168088120 19:54063435-54063457 CCGTCGGAATAGAGGAGGGCTGG - Intronic
1202691305 1_KI270712v1_random:96971-96993 GCACCAGGGCAGAGGAGGGCAGG + Intergenic
925182732 2:1827451-1827473 CCTTCTAGGCAGAGGGTGGCGGG - Intronic
925189061 2:1868560-1868582 CCTTCGGGGCCGGGGAGAGGGGG - Intronic
925607430 2:5673376-5673398 CTTCCAGGGCAGCGGAGGGCGGG - Intergenic
925785946 2:7431440-7431462 CCTTCCGGGCAGGTGAGGCCAGG + Intergenic
925965277 2:9059931-9059953 CTTTCTGGGAAGAGCAGGGCAGG + Intergenic
926221263 2:10937138-10937160 CTTTCTGGGCAGAGGGGGGCAGG - Intergenic
926303398 2:11619391-11619413 CCTGTGGGGAGGAGGAGGGCTGG + Intronic
927159228 2:20242396-20242418 CCCGCGGCGCAGGGGAGGGCCGG + Intergenic
927205729 2:20609168-20609190 CCTTGGGGGCAGAGGCCGCCAGG + Intronic
927468092 2:23351786-23351808 CCTCCCCGGGAGAGGAGGGCAGG - Intergenic
927702772 2:25278242-25278264 ACTTGGGGGCAGGGGAGGCCAGG + Intronic
927713939 2:25341186-25341208 CCCGCGGGGCCGAGGAGGGCCGG + Intronic
929501291 2:42493637-42493659 CCCCCGGGCCAGCGGAGGGCAGG - Exonic
929906926 2:46054660-46054682 AATTCGGGGCAGAAGAGGGCAGG + Intronic
932493971 2:72137607-72137629 CCCACGGGGCAGGGCAGGGCAGG - Intronic
932771440 2:74502897-74502919 CCTTTGGCACAGAGGAGGACGGG - Intronic
933695553 2:85214581-85214603 CCTTGGGGGCAGAGGAATGTTGG + Intronic
933699751 2:85245961-85245983 CTTTCTGGGCAAAGGAGAGCTGG - Intronic
933955085 2:87356979-87357001 GCACCAGGGCAGAGGAGGGCAGG - Intergenic
933990899 2:87633190-87633212 CCCAGGGGGCAGAGAAGGGCAGG + Intergenic
934239274 2:90253193-90253215 GCACCAGGGCAGAGGAGGGCAGG - Intergenic
934273910 2:91563505-91563527 GCACCAGGGCAGAGGAGGGCAGG + Intergenic
934323390 2:91985741-91985763 GCACCAGGGCAGAGGAGGGCAGG - Intergenic
934461717 2:94216547-94216569 GCACCAGGGCAGAGGAGGGCAGG - Intergenic
934558162 2:95298310-95298332 CCAGAGGGGCAGTGGAGGGCTGG + Intronic
934983731 2:98869308-98869330 CTCACGGGGCACAGGAGGGCTGG - Intronic
935268790 2:101416106-101416128 CCATCTGGGCAGTGGAGGCCAGG + Intronic
936302943 2:111317633-111317655 CCCAGGGGGCAGAGAAGGGCAGG - Intergenic
936451357 2:112636133-112636155 CTTTCAGGGTAGAGGAGAGCAGG + Intergenic
937891253 2:126940596-126940618 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
937987080 2:127642757-127642779 GCTGCAGGGCAGAGGTGGGCTGG - Intronic
938793766 2:134701465-134701487 CCTTCTGGGCAGAGCTGGGGAGG - Intronic
938860070 2:135359015-135359037 CTTTCTGGGATGAGGAGGGCAGG - Intronic
945113628 2:206389367-206389389 CTTTCTGGGAAGAGTAGGGCAGG + Intergenic
946228783 2:218279091-218279113 CCTGTGGGGCACAGGAGGACAGG + Exonic
946351856 2:219160569-219160591 CCTCCGGGGGAGGGGTGGGCGGG - Intronic
946446579 2:219745220-219745242 CCCTCATGGCAGAAGAGGGCAGG + Intergenic
947020854 2:225674013-225674035 CATTCGGGGCTGAGGAAGTCAGG + Intergenic
947758539 2:232587027-232587049 GCTTCGGAACAGATGAGGGCCGG + Intergenic
948253679 2:236551048-236551070 CCTACAGGGCTGAGGAAGGCAGG - Intergenic
948461694 2:238132781-238132803 GCTCTGGGGCTGAGGAGGGCTGG + Exonic
948601579 2:239110801-239110823 CCTGCAGGGGAGAGGAGGGAAGG - Intronic
948661222 2:239507841-239507863 CCTTCGGGCTGGAGGACGGCAGG + Intergenic
1169036123 20:2453822-2453844 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1169068415 20:2707347-2707369 GCTTCTGGGCAGAGGGAGGCTGG + Intronic
1169123597 20:3111731-3111753 CCTTGGAGGCTGAGAAGGGCTGG - Intronic
1170938163 20:20827496-20827518 CCTTCGGGGCAGGAAAGGGCTGG + Intergenic
1171206264 20:23283576-23283598 CTTTCTGGGCAAGGGAGGGCAGG + Intergenic
1171215829 20:23351264-23351286 CTCTCGGGTCTGAGGAGGGCCGG + Intronic
1171878258 20:30598154-30598176 CCTTAGGAGGGGAGGAGGGCAGG - Intergenic
1172163796 20:32886527-32886549 CCTTTGGGGAAGAAGAGGCCTGG + Intronic
1172530175 20:35625639-35625661 CCCTCAGGGCAGAGCTGGGCTGG - Intergenic
1173869348 20:46331803-46331825 CCGCAGGGGCAGAGGAGGGAGGG + Intergenic
1174053597 20:47784155-47784177 CTTTTGGGGCAGAGAAGGGGAGG - Intronic
1174406922 20:50308856-50308878 CCGTCTGGGAAGAGGAGGCCGGG - Intergenic
1175284535 20:57829106-57829128 CCTGAGGGGCAGGGCAGGGCAGG + Intergenic
1175413093 20:58784425-58784447 CAGACGGGACAGAGGAGGGCTGG + Intergenic
1175756508 20:61533575-61533597 CCTCATGGGCAGAGGAAGGCAGG - Intronic
1176117937 20:63441186-63441208 CCTGCGGGGGAGGTGAGGGCGGG + Intronic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1176592805 21:8659530-8659552 GCACCAGGGCAGAGGAGGGCAGG - Intergenic
1177703782 21:24674185-24674207 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1178223628 21:30689397-30689419 CATTCTGGGCAGAAGAGGGCAGG + Intergenic
1178354629 21:31900283-31900305 CCAGCTGGGCAGAGGAGGGCAGG - Intronic
1178493614 21:33070074-33070096 CCTGCGGGGCAGCGGGTGGCGGG - Intergenic
1178506937 21:33170140-33170162 CCAAGGGAGCAGAGGAGGGCAGG - Exonic
1179008071 21:37531762-37531784 CCCGCAGGGCAGAGGAGGGGAGG + Intergenic
1179189240 21:39108841-39108863 CCTCCCTGGCAGATGAGGGCAGG + Intergenic
1179349610 21:40595542-40595564 CCTTCAGGGCAGAGCTTGGCTGG - Intronic
1180275658 22:10636672-10636694 GCACCAGGGCAGAGGAGGGCAGG - Intergenic
1180550139 22:16531612-16531634 ACACCAGGGCAGAGGAGGGCAGG - Intergenic
1180935380 22:19622039-19622061 AATCCGCGGCAGAGGAGGGCAGG - Intergenic
1181015105 22:20064124-20064146 CCTTCCAGACAGAGGAGGCCTGG + Intronic
1181354535 22:22290209-22290231 GCACCAGGGCAGAGGAGGGCAGG + Intergenic
1181407901 22:22697858-22697880 CCTTTGCCTCAGAGGAGGGCGGG - Intergenic
1181602534 22:23960944-23960966 CGCTCAGGGCAGAGCAGGGCGGG + Intronic
1181605980 22:23980363-23980385 CGCTCAGGGCAGAGCAGGGCGGG - Intronic
1181636639 22:24177761-24177783 CCTTTGGGGGAGAGCAGGGTTGG - Exonic
1183617512 22:38954501-38954523 GCTTCTAGGCTGAGGAGGGCGGG + Intronic
1184391568 22:44206295-44206317 TCTGCGGGCCAAAGGAGGGCAGG - Exonic
1185169308 22:49283167-49283189 CCTGGTGGGCAGAGGAGGCCAGG + Intergenic
950164090 3:10780552-10780574 CCTTGGAGGACGAGGAGGGCTGG - Intergenic
951527288 3:23665568-23665590 ACTTCGGGGCAGAGGATAGGAGG - Intergenic
953886089 3:46715121-46715143 CACTGGGGGCAGAGGAGGGATGG - Intronic
954443766 3:50535761-50535783 CCTTGGGAGCAGGGGTGGGCTGG - Intergenic
954541811 3:51398114-51398136 CCTTCGTGCCAGAGGTGGGGAGG - Intronic
954563594 3:51579401-51579423 AATTCTGGGCAGAAGAGGGCAGG - Intronic
954655980 3:52194608-52194630 CCTTCAGGGCAGAGGCCTGCAGG - Intergenic
954711541 3:52507461-52507483 CATTCCAGGCAGAGGAGAGCAGG - Intronic
954894188 3:53961912-53961934 GCTTTGGGGCAGGTGAGGGCTGG + Intergenic
954906510 3:54067738-54067760 CCCTCTGGGCAGAGGGGGCCAGG - Intergenic
955404814 3:58619432-58619454 CCTACGAGGCTGAAGAGGGCTGG + Intronic
955823859 3:62924468-62924490 CATCAGGGGCAGAGGTGGGCTGG - Intergenic
956622442 3:71234863-71234885 GCTTCAGGGCAGAACAGGGCAGG + Intronic
957414184 3:79879017-79879039 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
960586380 3:119324070-119324092 CCTTCGGTGTAGAGCAGGGATGG - Intronic
961604932 3:128086532-128086554 CATTTGGGGCAAAGGTGGGCAGG + Intronic
961869768 3:129978857-129978879 CTTTTGGGGCAGAGGGAGGCAGG + Intergenic
962285885 3:134085245-134085267 CCAATGGGGCAGAGGAAGGCAGG - Intronic
962368017 3:134798365-134798387 CCAGAGGGGCAGAGGAGGGGAGG + Intronic
962616501 3:137131723-137131745 GCTTGGGGCTAGAGGAGGGCTGG + Intergenic
963040079 3:141064018-141064040 CCCTGGGGGAAGAGGAGGGCAGG - Intronic
963730062 3:148962659-148962681 CCTCCTGGGTAGAGGAGGGGAGG - Intergenic
963858378 3:150280383-150280405 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
964790464 3:160449804-160449826 CCTTCGGGGCAGAGGAGGGCGGG - Exonic
965571363 3:170177081-170177103 CCTTAGGGGCAGAGGGGGAAGGG - Intronic
965813441 3:172614397-172614419 GCTCCAGGGCAGAAGAGGGCTGG - Intergenic
966700386 3:182842647-182842669 CCTTGGGGTGAAAGGAGGGCAGG + Intronic
966816649 3:183895404-183895426 CCTTCTGGTCAGGAGAGGGCAGG + Intergenic
966885596 3:184376351-184376373 ACTTCTGGGCAGAGTAGGGTGGG + Exonic
967269897 3:187724888-187724910 CCTGCGGGGATGTGGAGGGCAGG - Intronic
968133110 3:196203668-196203690 CATTCTGGGCAGGGGAGGGAGGG + Intronic
968434796 4:578926-578948 TGTCCGGGGCAGGGGAGGGCAGG - Intergenic
968506365 4:973105-973127 CTTTCGGGGGAGTGGAGGGCGGG - Intronic
969213879 4:5708305-5708327 CCTCCGGGGCGGAGCGGGGCGGG - Exonic
970404018 4:15744684-15744706 GCTTAGGGGCAGAGGAGTGCTGG + Intergenic
971427422 4:26530226-26530248 AGTTCTGGGCAGACGAGGGCAGG + Intergenic
972566703 4:40276084-40276106 CTTTGGGGGCAGAGGAGGGTGGG - Intergenic
975640595 4:76496201-76496223 GCTTCTGGGGTGAGGAGGGCAGG + Intronic
977827549 4:101551698-101551720 AATTCTGGGCAGAAGAGGGCAGG + Intronic
978287832 4:107099222-107099244 CCTTCAGGGCAGTGGGGTGCAGG - Intronic
978593833 4:110355775-110355797 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
981748021 4:148069381-148069403 CCTTCCAGGGAGGGGAGGGCTGG + Intronic
983987233 4:174073868-174073890 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
984215737 4:176910899-176910921 CCTCCTGGGCAGAGGAAGGGCGG + Intergenic
985531691 5:437368-437390 GTCTCGGGGCCGAGGAGGGCAGG + Exonic
985578468 5:684559-684581 CCTTGGTGGGACAGGAGGGCTGG - Intronic
985593396 5:776699-776721 CCTTGGTGGGACAGGAGGGCTGG - Intergenic
986631700 5:9780316-9780338 CTTTCAGTGCAGTGGAGGGCTGG - Intergenic
988455229 5:31381634-31381656 CCATCCAGGCAGAGGAGGGATGG - Intergenic
992365478 5:76084811-76084833 CCGGCGGGGCAGAGGGGGGCGGG + Intronic
992903957 5:81326704-81326726 CTCTCTGGGCAGAGGAGGCCTGG - Intergenic
994188135 5:96838174-96838196 AATTCTGGGCAGAAGAGGGCAGG - Intronic
994245425 5:97471248-97471270 GCTTCTGGGCAGAAGAGAGCAGG - Intergenic
996101565 5:119450323-119450345 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
996502207 5:124229958-124229980 AATTCTGGGCAGAAGAGGGCGGG + Intergenic
996804677 5:127441245-127441267 CATTCGGTGGGGAGGAGGGCTGG + Intronic
997442460 5:133918614-133918636 CCTTCAGACCGGAGGAGGGCAGG - Intergenic
997824970 5:137098286-137098308 ACTGTGGGGAAGAGGAGGGCTGG - Intronic
999378723 5:151105040-151105062 CCTCCGGGGCGGGGGAAGGCGGG + Intronic
999462724 5:151771176-151771198 GCTGCGGGGCAGAGGAAGGAGGG - Intronic
999679119 5:154038925-154038947 CCTTCAGCGCAGAGGCGTGCCGG + Intronic
1001503480 5:172257135-172257157 CCTTGAGGGCAGAGGATGGGAGG - Intronic
1002307130 5:178290466-178290488 CCTTCCGGGGAGAGGTGGCCAGG - Intronic
1002963703 6:1941811-1941833 CCTCCAGGGCACAGGAGAGCAGG + Intronic
1003092843 6:3118663-3118685 GCTTCGGGGCAGAGTGGGCCGGG + Intronic
1004395698 6:15245255-15245277 CCCGGGGGGCGGAGGAGGGCCGG + Intergenic
1004513671 6:16303437-16303459 CATTCTGGCCAGAGCAGGGCTGG - Exonic
1006082501 6:31575510-31575532 CCCTGGGGCGAGAGGAGGGCGGG - Intergenic
1007004436 6:38347182-38347204 ACTGCGGGGCAAAGGAGGGGAGG - Intronic
1007175516 6:39893911-39893933 CCTGCTGGGGATAGGAGGGCAGG - Intronic
1007282744 6:40724300-40724322 CCAGCGGGGCAGGGAAGGGCAGG - Intergenic
1007352898 6:41287130-41287152 CCCACGGGGCTGAGCAGGGCAGG - Intergenic
1008572978 6:52832737-52832759 CCTTGGGGGCACTGAAGGGCTGG + Intronic
1009524723 6:64729203-64729225 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1011750129 6:90447062-90447084 CCTGTGGGGCAGAGTAGGCCAGG + Intergenic
1012373850 6:98537607-98537629 CTTTCTGGGGAGAGCAGGGCAGG - Intergenic
1013995666 6:116304775-116304797 CATTCTAGGCAGATGAGGGCTGG - Intronic
1016549009 6:145255870-145255892 AATTCTGGGCAGAAGAGGGCAGG - Intergenic
1018766147 6:166934379-166934401 CCTTCGGAGCATGGGAGCGCTGG + Intronic
1019636285 7:2077759-2077781 CTTCCGGAGCAGAGCAGGGCAGG - Intronic
1019665427 7:2249836-2249858 CCCTGCGGGCAGAGGTGGGCAGG - Exonic
1019912125 7:4107004-4107026 CATCCAGGCCAGAGGAGGGCAGG + Intronic
1020284169 7:6667496-6667518 AATTCTGGGCAGAAGAGGGCGGG + Intergenic
1021038501 7:15831319-15831341 CCTTTGGTGCATAGGAAGGCAGG - Intergenic
1022339489 7:29455059-29455081 CCTTCAGGGCAGGGGTAGGCAGG + Intronic
1025139100 7:56448062-56448084 CCTTCGGCGCAGGGTGGGGCTGG - Intergenic
1027361807 7:77416612-77416634 CCTTCGGGGCTGAGGATAGAGGG + Intergenic
1028101918 7:86831185-86831207 CCTTTGGGGCTGAGGAAGGGTGG + Intronic
1029537146 7:101163527-101163549 CCGAGGGGACAGAGGAGGGCGGG - Exonic
1030788784 7:113697089-113697111 CTTTCTGGGGAGAGCAGGGCAGG + Intergenic
1031529317 7:122856994-122857016 CCTTATGGGGAGAGGAGGGCTGG - Intronic
1031823099 7:126528931-126528953 CCTTAGGGGCAGAAGAGTGTAGG - Intronic
1034273858 7:149815667-149815689 CCTGAGGGGCACAGGAGGGAGGG - Intergenic
1034310602 7:150084563-150084585 CCTTCGGGGCAGAGGAGCAAAGG + Intergenic
1034433794 7:151053599-151053621 CCTCCTGGGCAGAGGAAGGGAGG + Intergenic
1034444725 7:151107942-151107964 CCTTCAGGCCATGGGAGGGCTGG + Intronic
1034796236 7:154016066-154016088 CCTTCGGGGCAGAGGAGCAAAGG - Intronic
1035184063 7:157112079-157112101 CGTTCTGGGCAGAGGAGGGCAGG - Intergenic
1035396830 7:158540341-158540363 CCCTCGGGCCAGAGGAGCCCTGG + Intronic
1035459625 7:159030935-159030957 CCTTGGGGGCAGAGGCTGGAGGG + Intronic
1035541593 8:443689-443711 ACCTCGGGGCAGCGGTGGGCGGG + Intronic
1037042269 8:14250771-14250793 CCTTGGGTGCATAGGAGCGCTGG - Intronic
1037910774 8:22742408-22742430 CGATGGGGGCAGAGGAGGGGAGG - Intronic
1038553736 8:28491769-28491791 CCTTGGGGGCAGAGGCGGTGAGG + Intergenic
1039470301 8:37809346-37809368 CTATCTGGGGAGAGGAGGGCAGG - Intronic
1041260436 8:56016931-56016953 CAGTCAGGGCGGAGGAGGGCAGG + Intergenic
1041398001 8:57411494-57411516 CTTTCTGGGAAGAGGAGGACAGG - Intergenic
1041466120 8:58159263-58159285 CCTTCTGGGAGGTGGAGGGCAGG - Intronic
1043567136 8:81560958-81560980 GCTGCGGGGCAAAGGAGGGAAGG + Intergenic
1045143809 8:99316287-99316309 CCTTAGTGGCAGCGGAGGGCAGG + Intronic
1048214212 8:132480702-132480724 CCTGGGGGGCAGGGGAGGCCAGG + Exonic
1049523663 8:143108984-143109006 CCATCGCGGAAGAGGAGGGCAGG - Intergenic
1049673367 8:143879263-143879285 CCTTGGGGACAGAGGAGGAGGGG - Intergenic
1049804833 8:144534095-144534117 CCTGGGGGGCCGGGGAGGGCAGG - Intronic
1051017830 9:12502507-12502529 CTTTTGGGGCATAGGTGGGCAGG - Intergenic
1051896464 9:21994446-21994468 CCTGCGGGGCGGAGATGGGCAGG - Intronic
1053070271 9:35097007-35097029 CCTTCGGAGTGGAGGAGGGGAGG + Intergenic
1053692191 9:40592199-40592221 GCACCAGGGCAGAGGAGGGCAGG - Intergenic
1054272609 9:63045286-63045308 GCACCAGGGCAGAGGAGGGCAGG + Intergenic
1054303449 9:63393165-63393187 GCACCAGGGCAGAGGAGGGCAGG - Intergenic
1054402228 9:64719675-64719697 GCACCAGGGCAGAGGAGGGCAGG - Intergenic
1054435833 9:65203990-65204012 GCACCAGGGCAGAGGAGGGCAGG - Intergenic
1054494559 9:65817697-65817719 GCACCAGGGCAGAGGAGGGCAGG + Intergenic
1056816786 9:89807636-89807658 TTTTGTGGGCAGAGGAGGGCAGG + Intergenic
1057227555 9:93300423-93300445 CCTTCTGGGCAGAGGTGCCCGGG - Intronic
1057744631 9:97741406-97741428 CCTGCCCGGCAGAGGCGGGCGGG - Intergenic
1058826886 9:108783135-108783157 ACTTTGGGACAGTGGAGGGCTGG - Intergenic
1059224534 9:112659691-112659713 CCGTCCGGGCAAAGTAGGGCTGG - Exonic
1059341918 9:113602154-113602176 CCTGCGGGGCAGAGGGAGGGAGG + Intergenic
1059764397 9:117370125-117370147 CCTTTGAGGTAGATGAGGGCGGG + Intronic
1060342738 9:122791325-122791347 TCTCCTGGGCTGAGGAGGGCAGG - Intergenic
1060790767 9:126484042-126484064 CCATCAGGGGAGGGGAGGGCAGG + Intronic
1061043738 9:128153484-128153506 CCTTCGAGGAAGGGGAGGGGCGG + Intergenic
1061428675 9:130517483-130517505 ACTTCGGGGCAGAGGGGAGAGGG - Intergenic
1062220608 9:135413239-135413261 CCTTCTCGGAAGAGGAGGGGAGG - Intergenic
1062268451 9:135698091-135698113 ACTCAGGGGCACAGGAGGGCTGG + Intronic
1062324945 9:136008314-136008336 CCCTTGGGGAAGAGGAAGGCAGG + Exonic
1062392123 9:136338057-136338079 CCTTCTGGGGAGGGGAGGGGAGG - Intronic
1062583077 9:137236839-137236861 CCGCCGGGGCAGAGGAGCTCCGG - Intergenic
1062609375 9:137367152-137367174 CCTGTGGGGCAGAGGAGGTGGGG - Intronic
1203622851 Un_KI270749v1:138336-138358 GCACCAGGGCAGAGGAGGGCAGG - Intergenic
1185460505 X:330978-331000 TCTCTGGGGCAGAGGCGGGCAGG + Intergenic
1185790028 X:2922293-2922315 CTTTCTGGGGAGAGCAGGGCAGG + Intronic
1186128674 X:6443089-6443111 AATTCTGGGCAGAAGAGGGCGGG - Intergenic
1187342811 X:18436436-18436458 CCTTGGGGGAAGAGGTGGGAAGG + Intronic
1188244237 X:27821351-27821373 CCGTCAGGCCCGAGGAGGGCTGG + Exonic
1188554841 X:31399566-31399588 AATTCTGGGCAGAAGAGGGCAGG - Intronic
1189548642 X:42070490-42070512 CCTGTGGGGCAGAGGGGAGCAGG + Intergenic
1190258468 X:48782960-48782982 GCTTTGGGGGAGACGAGGGCGGG - Intergenic
1190325584 X:49205081-49205103 CCTGCTGGGGAGGGGAGGGCAGG + Exonic
1196833523 X:119794572-119794594 CCCTTGGGGCAGGGGTGGGCAGG - Intergenic
1198299793 X:135324073-135324095 CTTTCTGGGGAGAGGAGGGCAGG + Intronic
1199336996 X:146630165-146630187 AATTCTGGGCAGAAGAGGGCAGG + Intergenic
1199991881 X:152992036-152992058 CCCTCCAGGCAGAAGAGGGCAGG + Exonic
1201190804 Y:11440728-11440750 GCACCAGGGCAGAGGAGGGCAGG - Intergenic