ID: 964794444

View in Genome Browser
Species Human (GRCh38)
Location 3:160481912-160481934
Sequence CAGTTGCAATGAAAGGTCTA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964794440_964794444 20 Left 964794440 3:160481869-160481891 CCTTGATAGAACGATCTAAATAG 0: 1
1: 0
2: 0
3: 0
4: 62
Right 964794444 3:160481912-160481934 CAGTTGCAATGAAAGGTCTACGG 0: 1
1: 0
2: 0
3: 9
4: 119
964794439_964794444 27 Left 964794439 3:160481862-160481884 CCGCAGGCCTTGATAGAACGATC 0: 1
1: 0
2: 0
3: 1
4: 47
Right 964794444 3:160481912-160481934 CAGTTGCAATGAAAGGTCTACGG 0: 1
1: 0
2: 0
3: 9
4: 119
964794442_964794444 -6 Left 964794442 3:160481895-160481917 CCGGAAAATAAGAGCTGCAGTTG 0: 1
1: 0
2: 2
3: 13
4: 146
Right 964794444 3:160481912-160481934 CAGTTGCAATGAAAGGTCTACGG 0: 1
1: 0
2: 0
3: 9
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964794444 Original CRISPR CAGTTGCAATGAAAGGTCTA CGG Intronic
904815403 1:33192708-33192730 CAGTTGGTAGGAAAGGTCCAAGG + Intergenic
905939178 1:41849255-41849277 CAGTGGTGATGAAAGGTCTCAGG - Intronic
908003547 1:59705842-59705864 CAGTTGCATTCAAAGGTCCAGGG - Intronic
909272275 1:73638527-73638549 CTGTTTCTCTGAAAGGTCTAGGG + Intergenic
909805100 1:79864739-79864761 CAGTGGCAAAGAAATTTCTAAGG + Intergenic
915747013 1:158169533-158169555 CAGTTGCTATGAGAGATCAATGG - Intergenic
918999956 1:191817992-191818014 CAGTTGCAAATAAAGTTCTTGGG + Intergenic
921513479 1:216061141-216061163 CAGTTGCAATGGAGAGTCCAAGG - Intronic
1066502311 10:36006254-36006276 AAGTTGCAAAGAAATGTATAGGG + Intergenic
1069117750 10:64528914-64528936 CAATAGCAATGAAACGTGTATGG + Intergenic
1070350196 10:75584165-75584187 CAGAAGCAATAAAAGGCCTATGG - Intronic
1071485562 10:86099865-86099887 CAGTTGCAATGCAGGGCCTCTGG - Intronic
1072600125 10:96918019-96918041 GAGTTGAAATAAAAGGTCTGGGG + Intronic
1073131268 10:101190539-101190561 AAGTGGCCAGGAAAGGTCTATGG - Intergenic
1075298410 10:121298465-121298487 CAGTTGAAATGACATATCTAAGG + Intergenic
1076442773 10:130491940-130491962 CAGTTGCAATGCATTTTCTAAGG + Intergenic
1078513225 11:12002035-12002057 CAGTTGCAAAGGAATGTCCAGGG - Intronic
1081128837 11:39351312-39351334 AAGTTGCAAAGAAATGTATAGGG + Intergenic
1081619890 11:44613233-44613255 CATTTGCCCTGAAAGGTCTCTGG + Intronic
1092485489 12:8899123-8899145 CAGTCGCAATAAAAGCTGTAAGG + Intergenic
1097958292 12:65508457-65508479 CAGATGCAAGGGAAGGTCTCTGG + Intergenic
1099416095 12:82388468-82388490 GACTGGCAATGAAAGGTCTAAGG + Intronic
1101337240 12:103807491-103807513 GAGAAGCAATGAAAGCTCTATGG - Intronic
1104107348 12:125675514-125675536 CAGTTGAAATGAAAGGTTAGGGG - Intergenic
1104711282 12:130988583-130988605 CTCTTGCAATGGAAGCTCTAGGG + Intronic
1107821491 13:44289632-44289654 AAGTTGCATTCACAGGTCTAGGG + Intergenic
1108066320 13:46581268-46581290 CAGTTGCACACAGAGGTCTAGGG - Intronic
1109777725 13:67064199-67064221 CAGTTGTAAACAAGGGTCTATGG - Intronic
1110474408 13:75896984-75897006 CTGTTGCAATGACAGATCTCTGG + Intergenic
1110705626 13:78600656-78600678 CCGTTCCAATGAGAGGCCTATGG - Exonic
1115302813 14:31903331-31903353 CACTTCCAATGAAAGGAATATGG - Intergenic
1115543297 14:34442590-34442612 CAGTTGCAATGAATGCTGTTTGG + Intronic
1117896716 14:60495121-60495143 CTGTTCCAATGTAAGATCTATGG - Intronic
1118371434 14:65140670-65140692 CAGGTGGGATGGAAGGTCTAGGG - Intergenic
1124893063 15:33750516-33750538 AAGTTACAATGAAATGTTTAAGG - Intronic
1125135263 15:36333763-36333785 AAGTTGAAATGAAATGTCTTTGG + Intergenic
1126983463 15:54274069-54274091 CAATTGTAATGAAAGCTCTGGGG - Intronic
1133636275 16:7668845-7668867 GAGTTGCAATGCAAGGACTAAGG + Intronic
1135583875 16:23652287-23652309 CAGTTGTAAATAAAGGTCTGAGG - Intronic
1138086189 16:54135735-54135757 CAGTTCCAAGGACAGGTCTTTGG - Intergenic
1143482352 17:7234869-7234891 CAAATACAATGAAAGCTCTAAGG + Intergenic
1143629718 17:8131556-8131578 CAGTTGCAGTGAAATGCCGAAGG - Intergenic
1147688872 17:42303318-42303340 CAGCTGCAATGCAAGCTCAAAGG - Intronic
1153118758 18:1693997-1694019 CAGTAGCAATGAAAGGAATCAGG - Intergenic
1153617310 18:6946789-6946811 AAGTTGCAATGAAATGTACAGGG - Intronic
1155768611 18:29670061-29670083 CAATTGCTATGAACTGTCTATGG + Intergenic
1164758442 19:30708453-30708475 CAGTGGCCATGAAAGATCTGGGG + Intronic
1165298586 19:34950417-34950439 CAGTTGAAATGAAAGGACACTGG + Intergenic
929833641 2:45373878-45373900 CAGTTGCAAGGACATGTGTATGG + Intergenic
933157380 2:78991290-78991312 CAGTTGCAAGGGATGGTCCAGGG + Intergenic
934958181 2:98642283-98642305 CAGTGGCAATGGAAGGACTCTGG + Intronic
936806556 2:116339640-116339662 CAGTTGCATTGAAAAGTATTGGG - Intergenic
937364135 2:121248772-121248794 CAGTGGAAAAGAAAGGTCTGTGG - Intronic
940226588 2:151407765-151407787 CATTTGTAATGAAAGGACTACGG - Intergenic
941637171 2:167947149-167947171 CAAGTGCAATGAAAAGCCTATGG + Intergenic
943471644 2:188301684-188301706 CAGGTGAAATGAGAGGACTAAGG + Intronic
943672403 2:190677392-190677414 CATTTGGAATGAAATCTCTAGGG + Intronic
944415591 2:199476506-199476528 CAGTAGCAATGAACTGTCTCTGG + Intergenic
944480596 2:200153806-200153828 CAGGTGCACTGATAGGTCTGGGG + Intergenic
945412552 2:209528606-209528628 CAGCTACAGTGAAAGGTCTGGGG - Intronic
1171190651 20:23156842-23156864 CAGTGGCCCTGAAAGGTGTATGG + Intergenic
1178426622 21:32484064-32484086 CAGTTGAAAGGAATGATCTATGG - Intronic
1178732801 21:35120405-35120427 CAGTTCCTTTGAAGGGTCTATGG - Intronic
1179295006 21:40053833-40053855 CAGATGCCATGAGTGGTCTATGG - Intronic
950307137 3:11924715-11924737 CAGTTGAAATGGAATCTCTAGGG + Intergenic
950330661 3:12153624-12153646 CTGTTGGAACGAAAGCTCTATGG - Exonic
951704699 3:25532018-25532040 CAGTTTTAATGAAATGTTTAAGG + Intronic
956203126 3:66728226-66728248 CAGTTGCAACCAGAGCTCTAAGG - Intergenic
956655669 3:71547888-71547910 TAGTTGGAAGAAAAGGTCTAAGG + Intronic
960977746 3:123192436-123192458 CAGGTGCAATGCACGGTCTTGGG - Intronic
962012203 3:131402619-131402641 CAGATGCAATCAAAGCTCTGAGG - Intergenic
963291134 3:143490757-143490779 CAGTGCCAATGAAAGGGCTCAGG + Intronic
964461666 3:156938305-156938327 AAGTTGCAAAGAAATGTGTAGGG - Intronic
964794444 3:160481912-160481934 CAGTTGCAATGAAAGGTCTACGG + Intronic
964813123 3:160687072-160687094 CATTTGAAATGACAGTTCTAAGG - Intergenic
965467899 3:169055169-169055191 CAGTAGAGATGAAAAGTCTAGGG - Intergenic
967096233 3:186179713-186179735 CAGATGCCATGAGAGGTCTGCGG + Intronic
967929089 3:194677679-194677701 CAGTTTGAATGAAAGATCCATGG + Intergenic
970352172 4:15213336-15213358 CAGCTCCAATGAAAAGTCAACGG + Intergenic
971035670 4:22690110-22690132 GGGTTGCAATGGAAGGTCTTAGG + Intergenic
974671299 4:65033665-65033687 CAGTTGTAAGGAGATGTCTAAGG - Intergenic
977712318 4:100141503-100141525 CAGGTGAAATTAAAGTTCTAAGG + Intergenic
982029777 4:151288715-151288737 CAGTTGCAATGAATAATCTAAGG + Intronic
982114101 4:152082801-152082823 CACTTGCTATGAAAAGTCCAGGG + Intergenic
982803051 4:159728112-159728134 CATTTGCAATGTAATGGCTAAGG - Intergenic
987096228 5:14552916-14552938 CAGGTGCAAAGAAAGGCCTTTGG - Intergenic
988399295 5:30741226-30741248 TAGCTCCAAAGAAAGGTCTAAGG - Intergenic
989415059 5:41164456-41164478 GAGTTGAAATGGAAGGTCCAGGG + Intronic
991145123 5:63292983-63293005 CAGTTGGAATGGAAGGTTGAGGG - Intergenic
994242544 5:97442048-97442070 CAGTTGAAATTAAAGGATTAAGG + Intergenic
995358327 5:111264931-111264953 CATTTGTACTGAAAGGTCAACGG - Intronic
996787793 5:127259419-127259441 GAGTTGCACTGAAATGTCAAAGG + Intergenic
997380558 5:133433471-133433493 CAGTTTCAATGAAATGTTTTTGG + Intronic
999723688 5:154417633-154417655 TAGCTGCAAAGAAATGTCTAGGG - Exonic
1003047758 6:2749939-2749961 CAGATGCAAGGAAAGGTATCTGG - Intronic
1005737459 6:28761750-28761772 CTGTTGAAATGGAAGGCCTAGGG - Intergenic
1005742590 6:28806275-28806297 CTGTTGAAAGGGAAGGTCTAGGG - Intergenic
1009313863 6:62192851-62192873 CACTTGCAATGAATGGTCACTGG - Intronic
1009615300 6:65997770-65997792 CTGTTTCAATGAAATGTCTGTGG - Intergenic
1016330857 6:142950544-142950566 CAGGTGCAATGACATGACTAAGG - Intergenic
1018733928 6:166673339-166673361 CAGTTGGAATGACAGCTCTGGGG - Intronic
1020195629 7:6036092-6036114 CAGTTGCAATGTAAGAGATACGG + Exonic
1021093070 7:16505495-16505517 CAGTTGCAATGATATTGCTAAGG - Intronic
1021474674 7:21047424-21047446 CAGATGGAATGAAAGTTTTATGG - Intergenic
1023665308 7:42516678-42516700 CAGTTGCAAAGAAAGCTCAGTGG + Intergenic
1028548836 7:92033935-92033957 CAACTGGAATGTAAGGTCTATGG - Intronic
1033441000 7:141378754-141378776 CAGTAGCAATGAAAGCTCTGTGG - Intronic
1038026471 8:23595437-23595459 CAATAGCAATTAAAGGTCTCAGG + Intergenic
1039366459 8:36933132-36933154 CAGTTGCAAGGAAGGGTGCATGG + Intronic
1039460968 8:37744035-37744057 CAGTTGCACGGAAAAGACTAAGG - Intronic
1040644472 8:49382242-49382264 CAGATGCAAGGAAAGGTCAGTGG + Intergenic
1045056374 8:98371764-98371786 CAGTTGCATTGAGGGCTCTAGGG + Intergenic
1045106901 8:98901530-98901552 GAGTTGCAAGAAAAGGTCTAAGG - Intronic
1045145987 8:99345390-99345412 CAGTTGCAATAAAGGCTGTATGG - Intronic
1046595932 8:116261157-116261179 CAGTTACAATGTATGGTTTACGG - Intergenic
1051193438 9:14537585-14537607 CAGTTGCAATGAGATCTCGAGGG - Intergenic
1052399211 9:27979367-27979389 CAGTTAAAAGGAAAGGCCTAGGG + Intronic
1052454254 9:28674380-28674402 AAGTAGCACTGAAAGTTCTAGGG - Intergenic
1057582407 9:96298940-96298962 CAGCAGCAATTAAAGGCCTATGG + Intronic
1186862964 X:13691234-13691256 CAGTTGAAATGTAAGCTCTGGGG - Intronic
1188186221 X:27117898-27117920 CAGTTGAAAAGTAAGGTCTAGGG - Intergenic
1189591443 X:42516717-42516739 CAGTTACAAAGAAATGTTTAAGG + Intergenic
1191178739 X:57536889-57536911 CAGATGCAATCAAAGGGCTGGGG + Intergenic
1192699860 X:73457435-73457457 GAGTTGCAAAGAAAGGTCTTTGG + Intergenic
1194909520 X:99623599-99623621 AGGTTTCAATGAAAGGTGTATGG + Intergenic
1197570788 X:128147797-128147819 CTGCTGCACTGAAAGGGCTAAGG - Intergenic
1198373076 X:136010787-136010809 CACTTGCAGTGAAAGTTTTAGGG - Intronic
1198717217 X:139570846-139570868 CAGTTGAAGTGAATGCTCTATGG - Intergenic
1198983203 X:142423111-142423133 AAGTAGCAATGCAATGTCTAAGG + Intergenic