ID: 964802249

View in Genome Browser
Species Human (GRCh38)
Location 3:160568869-160568891
Sequence CAGCTTGGAGAGCTTGGCAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 2, 2: 5, 3: 36, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964802249_964802257 28 Left 964802249 3:160568869-160568891 CCAATGCCAAGCTCTCCAAGCTG 0: 1
1: 2
2: 5
3: 36
4: 196
Right 964802257 3:160568920-160568942 GGAGCTGATGAAAGTCAAGCTGG 0: 1
1: 22
2: 16
3: 19
4: 232
964802249_964802255 7 Left 964802249 3:160568869-160568891 CCAATGCCAAGCTCTCCAAGCTG 0: 1
1: 2
2: 5
3: 36
4: 196
Right 964802255 3:160568899-160568921 CTCTGCAACGTGTGAGTACCAGG 0: 1
1: 0
2: 1
3: 7
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964802249 Original CRISPR CAGCTTGGAGAGCTTGGCAT TGG (reversed) Intergenic
901617430 1:10552966-10552988 CAGCTTGGAAAGGTGGGCAAAGG + Intronic
906164769 1:43678068-43678090 CAGCTTTGAGTTCTTGGGATAGG + Intronic
906223701 1:44103709-44103731 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
906331029 1:44884363-44884385 CAGCATGCAGAGCTTTGAATGGG - Intronic
906613600 1:47220077-47220099 CAGCTTGCGGAGCTCGGCAAAGG + Exonic
908698831 1:66875583-66875605 CAGCTGGGAGAGTTTGGAATTGG + Intronic
909232283 1:73105878-73105900 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
912219863 1:107661200-107661222 CAGCTAGCAGATCCTGGCATGGG - Intronic
912430583 1:109626486-109626508 CAGCCTGGAGAGCTGGGGGTGGG + Intronic
914326238 1:146619500-146619522 CAGTTTGGAGAGCTGTGCAGTGG + Intergenic
915619812 1:157074298-157074320 CAGCTCGGACAACTTGGCGTTGG - Intergenic
916771854 1:167916910-167916932 AAGATTAGAGAGCTTGACATAGG - Exonic
916884485 1:169053753-169053775 GAGGTTGGAGAGGTTGGCAGGGG - Intergenic
919885612 1:201931973-201931995 CAGCTTTGAGGGCTTGGCTGAGG + Intronic
923641615 1:235767396-235767418 CAGCTATGAGAACTTGGCAAAGG - Intronic
1063462612 10:6224130-6224152 CAGCCTGGAGGGCGTGGGATGGG - Exonic
1070922733 10:80198384-80198406 CAGCTAGGAGGGCCTGCCATGGG + Intronic
1070979485 10:80632901-80632923 CTGCTTGTAGAGCTTGGCTGGGG + Intronic
1073129721 10:101179631-101179653 CAGCATGGGGAGCATGACATTGG - Intergenic
1074762125 10:116675021-116675043 CAGCTGGGAGGGCTTGGCCGGGG + Exonic
1075332290 10:121582425-121582447 CAACTTTCAGAGCTTGGCAGAGG - Intronic
1075653739 10:124147489-124147511 GAGCTTGGGGAGCTTGGGGTGGG - Intergenic
1077178836 11:1203319-1203341 CAGCCTGGAGGGCTTGGGCTGGG + Intergenic
1077730330 11:4723118-4723140 CAGCTCGGACAGCTTGGAGTTGG + Intronic
1084507259 11:69576035-69576057 CATCCAGGAGAGCTTGGCCTGGG - Intergenic
1085291599 11:75404213-75404235 CAGCTGAGAGTGCTTGGCAAAGG + Intronic
1088674515 11:112179504-112179526 CAACTTGGATTTCTTGGCATGGG + Intronic
1090262687 11:125332836-125332858 CTGCTTGGAGAGCTGGGCAAAGG - Intronic
1096609452 12:52791340-52791362 CAGCTCTTGGAGCTTGGCATTGG + Exonic
1096626435 12:52898813-52898835 CAGCTCGGACAACTTGGCGTTGG + Exonic
1096685582 12:53286327-53286349 AAGCTTGGAGAGCTTGGGTGAGG - Exonic
1097029746 12:56081938-56081960 CAGCTTGGGGAGCAGGGCAGGGG - Intronic
1098264703 12:68706675-68706697 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1100616998 12:96238502-96238524 CAGCCGGGGGAGCTTGGCAGTGG + Intronic
1102556665 12:113731227-113731249 CAGCCTTGAGATCTTGGCAGAGG - Intergenic
1102883998 12:116508270-116508292 GAGCTTGCAGAGCTTGGCGTTGG - Intergenic
1104529208 12:129553218-129553240 CAGAGTGAAGAGCTGGGCATCGG - Intronic
1114083399 14:19220120-19220142 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1115951625 14:38728077-38728099 CAGCTCGGACAGCTTGGTGTTGG - Intergenic
1116326902 14:43541259-43541281 CAGCTCGGACAGCTTGGCCTTGG + Intergenic
1117505571 14:56399091-56399113 CAGCTTGGAGAGCATGTGTTTGG + Intergenic
1119703571 14:76770700-76770722 GAGATGGGAGAGCTAGGCATGGG + Intronic
1119756160 14:77121187-77121209 CAGATGGGAGCGCTTGGCATGGG + Intronic
1120549027 14:85846531-85846553 CAGGTGAGAGAGCTTGGTATGGG - Intergenic
1120865626 14:89293268-89293290 CAGCATGGAGAGCGTGCCCTGGG - Intronic
1121873617 14:97431283-97431305 CAACGTGGAGAGCTTGGAAGAGG + Intergenic
1122354839 14:101116636-101116658 GAGCTTGGAGTGCTTGGAGTGGG - Intergenic
1202895013 14_GL000194v1_random:1889-1911 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1124014811 15:25865321-25865343 CAGCTTGGAGACCTTTCCAGAGG - Intergenic
1124874626 15:33580410-33580432 CAGCTGTGAGAGCATGACATTGG + Intronic
1125841030 15:42801347-42801369 CAGCTCAGACAGCTTGGCATTGG + Intronic
1127690803 15:61395039-61395061 CAGCTTGGAGACCTTTGCTAGGG - Intergenic
1128300977 15:66566077-66566099 CAGCTGGGGGAGCTTGGCGCTGG + Intergenic
1128386945 15:67156420-67156442 CAGCTTCAAGATCTGGGCATAGG + Intronic
1128842243 15:70859758-70859780 CAGCTCGGACAGCTTGGCGTTGG - Intronic
1129597927 15:76979384-76979406 CAGCTCGGACAACTTGGCATTGG + Intergenic
1131149336 15:90037091-90037113 CAGCTTGGAGGACCTGGCAGGGG + Intronic
1132207425 15:99995765-99995787 CAGCTTCGCGAGCTTCCCATGGG + Intronic
1132348560 15:101123018-101123040 CAGCTTGGTGGCCTTGCCATGGG - Intergenic
1133988256 16:10684780-10684802 CAGCAGGGTGAGCTTGGCATTGG - Intronic
1135065564 16:19306789-19306811 CAGGTTGCAGAGCTAGGCAGTGG + Intronic
1135239780 16:20793971-20793993 CAGCTCCGGGGGCTTGGCATAGG + Intronic
1136385441 16:29923081-29923103 TGGCTTGGAGAGCCTGGCTTTGG - Intronic
1136564900 16:31063995-31064017 GAGCTTGGAGAGCGCGCCATAGG + Exonic
1139106723 16:63835383-63835405 GAGCCTGGAGGGTTTGGCATGGG + Intergenic
1139478117 16:67213332-67213354 CAGCTTGCAGGGCTTGGGAATGG - Intronic
1140007329 16:71091446-71091468 CAGTTTGGAGAGCTGTGCAGTGG - Intronic
1140753718 16:78048831-78048853 CAGCTTGGACAGCTTGGCGTTGG + Intronic
1143091740 17:4452964-4452986 CAGCTGGGTGAGCTTAGCATAGG - Intronic
1144625674 17:16843344-16843366 CAGCTTTGAGAGTTTGAAATGGG + Intergenic
1144826551 17:18108584-18108606 CAGCCTGGAGAGCTGAGCATGGG - Intergenic
1144880757 17:18429376-18429398 CAGCTTTGAGAGTTTGAAATGGG - Intergenic
1145151478 17:20515011-20515033 CAGCTTTGAGAGTTTGAAATGGG + Intergenic
1145282491 17:21478099-21478121 CAGCCTGGAGAGCTTGCCCAGGG + Intergenic
1145394982 17:22487656-22487678 CAGCCTGGAGAGCTTGCCCAGGG - Intergenic
1146162828 17:30569261-30569283 CAGCTTTGAGAGTTTGAAATGGG + Intergenic
1147350063 17:39835346-39835368 CAGCTTGGACCCCCTGGCATTGG + Intronic
1147579833 17:41622039-41622061 CAGCTTTGAGAGTTTGAAATGGG + Intronic
1147732171 17:42610502-42610524 TGGGTTGTAGAGCTTGGCATAGG - Exonic
1147739130 17:42660228-42660250 TGGGTTGTAGAGCTTGGCATAGG - Exonic
1147862171 17:43530067-43530089 CAACATGGAGGGCTTGGCAGGGG + Intronic
1148759270 17:49991153-49991175 CAGACTGGAGACCTTGGGATGGG - Exonic
1148791474 17:50175618-50175640 CAACTGCGAGTGCTTGGCATTGG - Intronic
1148959806 17:51384057-51384079 CACCTTGCAGAGATTGTCATGGG + Intergenic
1151548648 17:74808609-74808631 AAGCTTGGAGAGCTTGGGAAGGG + Intronic
1153291053 18:3501768-3501790 CAGCCTGGGGAGCTGGACATTGG + Intronic
1154500082 18:14991783-14991805 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1155847473 18:30727633-30727655 CAGCCTGGAGGGCCTGACATTGG - Intergenic
1156263548 18:35466721-35466743 CAGCAGGGAGAGCCTGGCAGGGG + Intronic
1157063555 18:44321169-44321191 CAGCTCGGACAGCTTGGTGTTGG + Intergenic
1157427226 18:47594317-47594339 CTGCTTTGAGGGCTTGGCATAGG - Intergenic
1157606311 18:48928058-48928080 CAGCTTTTAGAGCTGCGCATGGG + Intronic
1159589834 18:70321777-70321799 CAGGTAGGACAGGTTGGCATAGG + Intronic
1159834553 18:73322862-73322884 CAGCTTGGAGAGTCTCACATTGG + Intergenic
1167449159 19:49556884-49556906 CAGCTTGGTGGCCTTGGCTTCGG + Exonic
1167528552 19:50000687-50000709 CAGCTGGGAGAGCTCGGCCGGGG - Intronic
925585591 2:5461141-5461163 GAGCATGGAGAGGGTGGCATAGG + Intergenic
925974336 2:9130691-9130713 CAGAGAGGAGAGCCTGGCATCGG - Intergenic
927007028 2:18861531-18861553 CAGCCTAGAGGGCTTGGCATGGG - Intergenic
927461961 2:23306962-23306984 CAGCATGGAGCACTGGGCATTGG - Intergenic
927948253 2:27150223-27150245 CAACTTGGAGAGCTTGGTGTCGG - Exonic
928225754 2:29446606-29446628 CAGCTTGGAGATCTTGGCAGTGG - Intronic
928557459 2:32442703-32442725 CAGTTTGGAGAATTTGGCAAGGG + Intronic
929780678 2:44955052-44955074 CAGCTTGGCGATCTTGTTATTGG + Intergenic
931438651 2:62271119-62271141 CAGCTAGGATACATTGGCATGGG + Intergenic
931512573 2:63016844-63016866 GACCTTGGAGAGCTGGGCCTTGG - Intronic
932134347 2:69215157-69215179 CTACTTGGAGAGCTTGGAATGGG - Intronic
932396157 2:71449947-71449969 GAGGTTGGAGAACTTGGCTTTGG + Intergenic
934573466 2:95385801-95385823 CAGCTGGGAGGGCTGGGCAGCGG - Exonic
935102083 2:100006653-100006675 GAACTTGGAGAGCTTGGCCTTGG + Exonic
936376964 2:111948951-111948973 CAGGATGGAGAGCATGGGATGGG - Intronic
938259286 2:129883677-129883699 CTGTTTGGAGAGCTGGGCATGGG + Intergenic
940041402 2:149365167-149365189 AACATTGGAGAGCTTTGCATGGG - Intronic
940690006 2:156904678-156904700 CAGGTTGGACAGCTTGGATTGGG + Intergenic
942558646 2:177198147-177198169 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
942927404 2:181450281-181450303 TAGCTTGATGAGCATGGCATTGG + Intergenic
944763445 2:202840715-202840737 CAGCTCGGAGAGCTTGGCATTGG + Intronic
945925325 2:215797242-215797264 AAGCTTTGGGTGCTTGGCATGGG - Intergenic
946496222 2:220198390-220198412 CAAGTTGGAGAGCCTGGGATGGG + Intergenic
949028218 2:241776054-241776076 CCGTGTGGAGAGCTTGGCGTCGG + Intergenic
1170148645 20:13205173-13205195 GTGCTTGGAGAGGTGGGCATGGG - Intergenic
1170874769 20:20240274-20240296 CAGCTTGGGAAGCTTGGCTAGGG + Intronic
1171225927 20:23442179-23442201 TAGCTGGGTGATCTTGGCATGGG + Intronic
1172112847 20:32557531-32557553 GAGGTTGCAGAGCTTGGCAGTGG - Intronic
1173001167 20:39106762-39106784 CAGCATGTAGAGCTTTGCACAGG + Intergenic
1174112069 20:48204111-48204133 CAGCCTGGAGAGGGAGGCATGGG - Intergenic
1174733707 20:52943443-52943465 CAATTTGCAGAGCATGGCATGGG - Intergenic
1175788397 20:61726097-61726119 CAGTGGGGAGAGCATGGCATGGG + Intronic
1175948701 20:62570920-62570942 CAGCTGTAAGTGCTTGGCATTGG - Intergenic
1176268325 20:64222284-64222306 CTGCTTGGTGAGCTTGGCCAGGG - Intronic
1176614716 21:9017876-9017898 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1176710495 21:10145995-10146017 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1177955847 21:27598113-27598135 CAGCTTGGAGAACTAGACACTGG - Intergenic
1178488880 21:33035406-33035428 CAGCTGGCAGAGCTTGGCCAAGG - Intergenic
1178693001 21:34765317-34765339 CAGCTTTGACAGCATGTCATGGG + Intergenic
1178745599 21:35247095-35247117 CAGCTTGTAGAACCTGGAATAGG + Intronic
1180294576 22:10873147-10873169 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1180497382 22:15902561-15902583 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1181027276 22:20133274-20133296 CAGCCTGGGGAGCCTGGCCTGGG + Intronic
1185399926 22:50610460-50610482 CAGTTTGGGGTGCTGGGCATGGG + Intronic
949942045 3:9162652-9162674 CAGCGTGGGGAGCTGGCCATGGG + Intronic
950242948 3:11388076-11388098 CATCTAGGAGAGCTTGGGAATGG - Intronic
950454711 3:13085812-13085834 CAGCCTCGAGAGCCTCGCATTGG - Intergenic
952611544 3:35216086-35216108 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
953192578 3:40701472-40701494 CTGCTTGGTGAGCTTGGCTTTGG + Intergenic
953715009 3:45309981-45310003 CAGCTTGGACAGTGTGGCACTGG - Intergenic
955789532 3:62574039-62574061 AAGCTTGAAGAACTTGGCAATGG - Intronic
955839480 3:63096756-63096778 CAGCTCGGACAGCTTGGCGTTGG + Intergenic
957853775 3:85846429-85846451 CAACTTGGAGAGTTAGGAATTGG - Intronic
961077899 3:123998689-123998711 CAGGCTGGAGAGCTTGCTATGGG - Intergenic
961239820 3:125400944-125400966 CAGCGTGGGGACCCTGGCATGGG - Intergenic
962712816 3:138101865-138101887 CAGCTCGGACAGCTTGGCGTTGG + Intronic
964802249 3:160568869-160568891 CAGCTTGGAGAGCTTGGCATTGG - Intergenic
967215070 3:187202895-187202917 CAGGCTGGAGAACTTGTCATTGG - Intergenic
967224271 3:187275905-187275927 CAGCTTGTAAAGCCTGCCATTGG + Intronic
972492399 4:39600203-39600225 CACATTGGAGAGCCTGGCATGGG - Intronic
974803080 4:66844256-66844278 GAGCTTGGAGAGATGGGCAAGGG + Intergenic
976022317 4:80643602-80643624 CTAGTTGGAGAGCTTGGCCTTGG + Intronic
976612857 4:87047548-87047570 CAGTTTGGTGAGCTTGGCTTTGG - Exonic
977928671 4:102729106-102729128 CAGCTTGGACAGCTTGGCGTTGG + Intronic
978101700 4:104849347-104849369 CAGCTTGGAGGGCTTCCCATTGG - Intergenic
982032734 4:151316857-151316879 AAGCTTGGATAGCTTGACACAGG - Intronic
985019526 4:185672816-185672838 TAGCTTACAGTGCTTGGCATTGG + Intronic
988597310 5:32606896-32606918 CAATTTGGAGAGCTTGGCTGTGG - Intergenic
990900488 5:60743939-60743961 CAGCTCAGACAGCTTGGCGTTGG + Intergenic
991468747 5:66944768-66944790 CAGCCAGGAGAGCTTGGAAGAGG - Intronic
996662870 5:126025580-126025602 TAGCTCAGAGTGCTTGGCATTGG - Intergenic
997588698 5:135059986-135060008 CAGTTTGGACATCATGGCATTGG + Intronic
998887174 5:146706559-146706581 CAGCTCGGACAGCTTAGCGTTGG + Intronic
998979213 5:147682264-147682286 CAGCTTGGAGAGGTAAGCAGTGG + Intronic
999731152 5:154477610-154477632 GATCTTGGAGAGCTTGGTGTCGG + Exonic
1001985881 5:176074209-176074231 CAGCTTGGAGTGTTTGGACTCGG - Intronic
1002264349 5:178019833-178019855 CAGCTTGGAGTGTTTGGACTCGG - Intronic
1003924517 6:10864339-10864361 CAGCTGGAAGAGCTGGGCAGAGG - Intronic
1005315506 6:24599398-24599420 CAGCTTGGACAGCTTGGCATTGG - Intronic
1005353477 6:24959907-24959929 CAGGTTGGAGAGTGTGGCTTAGG - Intronic
1010322511 6:74529080-74529102 CAGCCTGTAGAGTTTGGCAAGGG + Intergenic
1011241856 6:85280306-85280328 CAACTTGAAGAGATTGTCATTGG - Intergenic
1012253720 6:97008521-97008543 CAGCTCAGAGAGTTTGGCATGGG - Intronic
1012893304 6:104921189-104921211 AAGGATGGAGAGCGTGGCATTGG - Intergenic
1015496621 6:133889729-133889751 CAGCTTGGAGAGCTTGGTGTCGG - Exonic
1015539190 6:134297356-134297378 CAGCTCAGACAGCTTGGCGTTGG + Intronic
1017868031 6:158461628-158461650 CAGCTTGGTGAGCTTCCCAATGG + Exonic
1018317263 6:162569322-162569344 CAGCTTGGACAGCTTGGTGTTGG - Intronic
1019348960 7:544269-544291 CAGCGTGCAGAGGTTGGCCTAGG - Intergenic
1021094705 7:16522594-16522616 CAGCTTGCAGTGCTTTTCATTGG + Intronic
1021975395 7:26007075-26007097 CCGCTTGGAGAGGATGGCAAGGG + Intergenic
1022477031 7:30717899-30717921 CAGCTAGGAAATCTTGGAATAGG + Intronic
1022666648 7:32416993-32417015 CGGCTGGGAGAGCCAGGCATGGG - Intergenic
1023289658 7:38656239-38656261 CAGCTCAGACAGCTTGGCTTTGG - Intergenic
1026077990 7:67190927-67190949 CTGCTTGGAGAGTTTGCCTTGGG - Intronic
1026205279 7:68251875-68251897 CAGCTTTGAGAGCTTCCCAGGGG - Intergenic
1026273344 7:68855268-68855290 CAAATTGGAGAGATTGGTATTGG - Intergenic
1026382954 7:69817679-69817701 AAGCGTGGAGAGCTGGGCAGAGG + Intronic
1027171949 7:75878930-75878952 CGGATTGGACAACTTGGCATGGG + Exonic
1028567851 7:92252708-92252730 CAGCTTGAAGAGGTTACCATTGG - Intronic
1029217573 7:98962401-98962423 GAGCTGGGAGGGATTGGCATTGG - Exonic
1032485242 7:132282001-132282023 CATCTTGGAGGGCTTGACACTGG - Intronic
1033648401 7:143322036-143322058 CAGCTTGGGGAGCTTGGAGCAGG + Intronic
1033728430 7:144147188-144147210 CTGCTGGGATAGCCTGGCATTGG - Intergenic
1034818653 7:154196777-154196799 CAGCCTGGGGAGCTTGGCCTCGG - Intronic
1035095900 7:156355179-156355201 CAGCATGGAAAGCATGCCATGGG - Intergenic
1036710871 8:11077778-11077800 CAGATTGGAGCGGTTGCCATGGG - Intronic
1039814242 8:41078645-41078667 CAGCTTTCAGACCTTGGAATCGG + Intergenic
1041781144 8:61579265-61579287 CAGCTCGGACAACTTGGCGTTGG - Intronic
1042271541 8:66961502-66961524 CAGCTTGGACAGCTTGGTGTCGG + Exonic
1042722867 8:71843741-71843763 CAGCTTGGAGAGCTTAGTGTCGG + Exonic
1044459517 8:92428688-92428710 CAGCTTCCACAGCTTGGAATGGG + Intergenic
1044595611 8:93955661-93955683 CAGGTTGGGGAGCTGGACATGGG - Intergenic
1048442378 8:134469463-134469485 CAACTTGGAGGACTTGGCTTGGG + Intergenic
1048554267 8:135458606-135458628 CAGCCTGCAAGGCTTGGCATGGG - Intronic
1048734990 8:137489055-137489077 CAGAGTGGAGATCTTGGCTTTGG - Intergenic
1049073272 8:140373421-140373443 CTTCTTGGAGAGGGTGGCATTGG - Intronic
1049270344 8:141692384-141692406 CTGCTTTGAGAGCTTACCATGGG - Intergenic
1049749180 8:144275447-144275469 CAGCGTGGAGAGGCTGGCACCGG - Intronic
1049749190 8:144275482-144275504 CAGCGTGGAGAGGCTGGCACCGG - Intronic
1049749200 8:144275517-144275539 CAGCGTGGAGAGGCTGGCACCGG - Intronic
1049798343 8:144506532-144506554 CTGCTCGGTGAGCTTGGCCTTGG - Exonic
1052169856 9:25379727-25379749 CACCTTGGACAGCTTGGTAAAGG + Intergenic
1052372883 9:27685710-27685732 CAACTTGGTGTGGTTGGCATTGG + Intergenic
1052606881 9:30715366-30715388 CTGCTTGGGCAGCTTGGCATTGG + Intergenic
1053231281 9:36412172-36412194 GAGCTTGGAGAGGTGGGCATGGG - Intronic
1053647473 9:40131693-40131715 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1053758255 9:41332150-41332172 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1054328455 9:63729647-63729669 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1054537106 9:66244477-66244499 CAGCTGGAAGAGCTGGGCAGTGG + Intergenic
1056966396 9:91166172-91166194 CAGATAGGAGACCTTGACATTGG - Intergenic
1057314798 9:93961282-93961304 CAGCCTGGGGAGCTAGGCCTGGG + Intergenic
1057943653 9:99306205-99306227 CAGCTCGGACAGCTTGGCGTTGG - Intergenic
1060811903 9:126614888-126614910 CACCTTGGCGAGCTTGGGAGAGG + Intronic
1061817077 9:133203920-133203942 CCACTTGGAGGGCCTGGCATGGG - Intergenic
1062152725 9:135030199-135030221 CACCATGGAGAGCTTGGGACAGG + Intergenic
1202795258 9_KI270719v1_random:114990-115012 CAGCTGGAAGAGCTGGGCAGTGG - Intergenic
1187785133 X:22876089-22876111 CAGGTTGGAGAGGTTGTCAAAGG + Intergenic
1189893782 X:45632671-45632693 CAGCTCGGACAACTTGGCCTTGG + Intergenic
1191220765 X:57985727-57985749 CAGCTGGGAAAGCTTGGCATTGG - Intergenic
1191842131 X:65520847-65520869 CAGCATGGAGAGGTTTGGATAGG - Intronic
1192436303 X:71145589-71145611 CAGGATGGAGATCTTGGCCTTGG + Intronic
1194941677 X:100017564-100017586 CAGGTTGGAGGGCTGGGAATGGG - Intergenic
1195616472 X:106916432-106916454 CAGTTTGGAGAGCTAGGTAGGGG + Intronic