ID: 964803543 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 3:160581213-160581235 |
Sequence | GCTCAGCAGCAACATGCTGT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
964803542_964803543 | -7 | Left | 964803542 | 3:160581197-160581219 | CCAGATGAGAATGATTGCTCAGC | No data | ||
Right | 964803543 | 3:160581213-160581235 | GCTCAGCAGCAACATGCTGTAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
964803543 | Original CRISPR | GCTCAGCAGCAACATGCTGT AGG | Intergenic | ||