ID: 964803543

View in Genome Browser
Species Human (GRCh38)
Location 3:160581213-160581235
Sequence GCTCAGCAGCAACATGCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964803542_964803543 -7 Left 964803542 3:160581197-160581219 CCAGATGAGAATGATTGCTCAGC No data
Right 964803543 3:160581213-160581235 GCTCAGCAGCAACATGCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964803543 Original CRISPR GCTCAGCAGCAACATGCTGT AGG Intergenic
No off target data available for this crispr