ID: 964804600

View in Genome Browser
Species Human (GRCh38)
Location 3:160594513-160594535
Sequence AATTAGATGGACAAATTGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964804597_964804600 28 Left 964804597 3:160594462-160594484 CCTGTTTACTCTGTTGATAGTTT 0: 69
1: 299
2: 3360
3: 15241
4: 6090
Right 964804600 3:160594513-160594535 AATTAGATGGACAAATTGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964804600 Original CRISPR AATTAGATGGACAAATTGGA TGG Intergenic
No off target data available for this crispr