ID: 964807040

View in Genome Browser
Species Human (GRCh38)
Location 3:160621652-160621674
Sequence CATTGGTGCTATGTATGTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964807035_964807040 30 Left 964807035 3:160621599-160621621 CCATTGATTACATCTTTTGTATT No data
Right 964807040 3:160621652-160621674 CATTGGTGCTATGTATGTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964807040 Original CRISPR CATTGGTGCTATGTATGTGC AGG Intergenic
No off target data available for this crispr