ID: 964808679

View in Genome Browser
Species Human (GRCh38)
Location 3:160639339-160639361
Sequence CATTGGTACTAGATAGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964808679_964808685 20 Left 964808679 3:160639339-160639361 CCTGCTTCTATCTAGTACCAATG No data
Right 964808685 3:160639382-160639404 ACAATACTAACTCTGGGCTCTGG No data
964808679_964808680 -10 Left 964808679 3:160639339-160639361 CCTGCTTCTATCTAGTACCAATG No data
Right 964808680 3:160639352-160639374 AGTACCAATGAATCTCTGCTAGG No data
964808679_964808683 13 Left 964808679 3:160639339-160639361 CCTGCTTCTATCTAGTACCAATG No data
Right 964808683 3:160639375-160639397 GTCTTTGACAATACTAACTCTGG No data
964808679_964808681 -9 Left 964808679 3:160639339-160639361 CCTGCTTCTATCTAGTACCAATG No data
Right 964808681 3:160639353-160639375 GTACCAATGAATCTCTGCTAGGG No data
964808679_964808684 14 Left 964808679 3:160639339-160639361 CCTGCTTCTATCTAGTACCAATG No data
Right 964808684 3:160639376-160639398 TCTTTGACAATACTAACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964808679 Original CRISPR CATTGGTACTAGATAGAAGC AGG (reversed) Intergenic
No off target data available for this crispr