ID: 964809219

View in Genome Browser
Species Human (GRCh38)
Location 3:160644650-160644672
Sequence AACTTGCAACAGATGCAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964809214_964809219 -3 Left 964809214 3:160644630-160644652 CCTACACTGAGCCAGAACCAAAC No data
Right 964809219 3:160644650-160644672 AACTTGCAACAGATGCAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964809219 Original CRISPR AACTTGCAACAGATGCAATG GGG Intergenic
No off target data available for this crispr