ID: 964813563

View in Genome Browser
Species Human (GRCh38)
Location 3:160692476-160692498
Sequence TCTTATATGGACAGGGTTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964813563_964813568 21 Left 964813563 3:160692476-160692498 CCTTGAACCCTGTCCATATAAGA No data
Right 964813568 3:160692520-160692542 GTTCTTTCCGCTCCACCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964813563 Original CRISPR TCTTATATGGACAGGGTTCA AGG (reversed) Intergenic
No off target data available for this crispr