ID: 964814051

View in Genome Browser
Species Human (GRCh38)
Location 3:160697701-160697723
Sequence CAGTATGAGTAGAGTGAAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964814049_964814051 9 Left 964814049 3:160697669-160697691 CCTGGTGAAGGTGACATTTGAGT No data
Right 964814051 3:160697701-160697723 CAGTATGAGTAGAGTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964814051 Original CRISPR CAGTATGAGTAGAGTGAAAA TGG Intergenic
No off target data available for this crispr