ID: 964824665

View in Genome Browser
Species Human (GRCh38)
Location 3:160811947-160811969
Sequence TCAGTGCCACACCAAGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 0, 3: 22, 4: 207}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964824665_964824672 29 Left 964824665 3:160811947-160811969 CCAGGCACTTGGTGTGGCACTGA 0: 1
1: 0
2: 0
3: 22
4: 207
Right 964824672 3:160811999-160812021 AAGCAGGTTCCTCTGGACTATGG 0: 1
1: 0
2: 0
3: 15
4: 118
964824665_964824669 22 Left 964824665 3:160811947-160811969 CCAGGCACTTGGTGTGGCACTGA 0: 1
1: 0
2: 0
3: 22
4: 207
Right 964824669 3:160811992-160812014 AATCCCAAAGCAGGTTCCTCTGG 0: 1
1: 0
2: 0
3: 16
4: 151
964824665_964824668 13 Left 964824665 3:160811947-160811969 CCAGGCACTTGGTGTGGCACTGA 0: 1
1: 0
2: 0
3: 22
4: 207
Right 964824668 3:160811983-160812005 TATTACTTCAATCCCAAAGCAGG 0: 1
1: 0
2: 0
3: 7
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964824665 Original CRISPR TCAGTGCCACACCAAGTGCC TGG (reversed) Intronic
900716920 1:4150890-4150912 TCTGCACCACACCAGGTGCCTGG + Intergenic
901166146 1:7222933-7222955 TCTGTGCCACACAGGGTGCCGGG - Intronic
902555850 1:17246161-17246183 CCAGTGCCACGGCCAGTGCCAGG + Intergenic
903102750 1:21047205-21047227 TCTGTGCCCCACCAAGTTCATGG - Intronic
903653982 1:24937748-24937770 TCAGTGTCAAACCGAGGGCCTGG + Intronic
904942148 1:34171388-34171410 TCAGTGCCATTCAGAGTGCCTGG + Intronic
905788786 1:40779072-40779094 TCAGTGCCACACCCAGATCTGGG + Intergenic
907978030 1:59452705-59452727 TGACTGCCAGCCCAAGTGCCAGG - Intronic
908165632 1:61454933-61454955 TCAGTGCCTAGCCCAGTGCCTGG - Intronic
910598408 1:89004872-89004894 TCAGCGCCACACCCTGGGCCTGG + Intergenic
910970228 1:92848746-92848768 TCAGTGCCTCAAACAGTGCCTGG + Intronic
911232263 1:95373783-95373805 TCAGTGCCACACTGGGTGCTGGG + Intergenic
912597879 1:110897394-110897416 TCATAGCCCTACCAAGTGCCAGG - Intronic
913592679 1:120343172-120343194 TCAGTGCCACGTACAGTGCCTGG + Intergenic
913650672 1:120911958-120911980 TCAGTGCCACGTACAGTGCCTGG - Intergenic
914170441 1:145217109-145217131 TCAGTGCCACGTACAGTGCCTGG + Intergenic
914525557 1:148461075-148461097 TCAGTGCCACGTACAGTGCCTGG + Intergenic
914598113 1:149174754-149174776 TCAGTGCCACGTACAGTGCCTGG - Intergenic
914640841 1:149606053-149606075 TCAGTGCCACGTACAGTGCCTGG - Intergenic
914971218 1:152309338-152309360 TCACAGCCACACCACGTCCCAGG - Exonic
915091710 1:153430693-153430715 TCAGAGCCCCACCAGGTTCCTGG + Intergenic
918426865 1:184419498-184419520 TCAGTGAAACCTCAAGTGCCTGG - Intronic
919444814 1:197689782-197689804 TCAGTGCCAAGCATAGTGCCTGG - Intronic
920077679 1:203349049-203349071 CAAGTGCCACACCCAGTGCCAGG - Intronic
922219458 1:223547160-223547182 CCAGTGCCACCCAAAGTGCTGGG + Intronic
923655937 1:235917103-235917125 TCAGTGCCTAACCATGTGCCAGG + Intergenic
1063363714 10:5477212-5477234 CCAGTCCCTCACCAAGTGACTGG + Intergenic
1064252903 10:13720504-13720526 TCAGTGCCTGACACAGTGCCAGG - Intronic
1067051778 10:43025546-43025568 GCAGGGCCACAGCAGGTGCCAGG - Intergenic
1068515267 10:58018172-58018194 CCAGTGCCACACCCTGGGCCTGG + Intergenic
1069386575 10:67888084-67888106 TCAGTGCCTAAAAAAGTGCCTGG + Intronic
1073594545 10:104786810-104786832 TCAGTCCAGAACCAAGTGCCAGG - Intronic
1074493723 10:113960512-113960534 ACTGCTCCACACCAAGTGCCAGG + Intergenic
1074697344 10:116061702-116061724 TCAGTGGCACCCCAAATGCCCGG + Intronic
1074764713 10:116692127-116692149 TCAGTCCCACAACAAGAGCTGGG - Intronic
1075406510 10:122199175-122199197 GCAGTGCCACAATCAGTGCCTGG - Intronic
1076221474 10:128736810-128736832 GCAGTGCCAAACCAAGGGCTAGG - Intergenic
1077533929 11:3110063-3110085 TGAGTGCCCCACTATGTGCCAGG - Intronic
1077910131 11:6566159-6566181 TCAGAGCCAGACCTCGTGCCTGG + Intronic
1079109172 11:17594473-17594495 TCTGTGCCAGACCTAGTGCCAGG - Intronic
1079343413 11:19631688-19631710 TAGGTGCCACACTCAGTGCCGGG - Intronic
1080432766 11:32213951-32213973 TTAGTGCCTGACCTAGTGCCTGG - Intergenic
1083365553 11:62139709-62139731 TCAGGGCCACACCAGCTGCATGG + Intronic
1083836996 11:65276702-65276724 TCAGGGAAACACCAACTGCCAGG + Intronic
1084316432 11:68348391-68348413 TCAGAGTCACACCGAGTGCTGGG - Intronic
1085878976 11:80443119-80443141 TCAGTGTCTAACAAAGTGCCTGG - Intergenic
1086996829 11:93367903-93367925 ACAGTGCCTGACAAAGTGCCAGG - Intronic
1087866993 11:103241991-103242013 TCAGTGGCACACCAAGAGGGAGG - Intronic
1088672138 11:112152543-112152565 ACATGGCCACACCAAGTGCAAGG - Intronic
1089153181 11:116380385-116380407 TCAGTTCCAAACAATGTGCCTGG - Intergenic
1089180094 11:116577610-116577632 TCAGTTTCAGCCCAAGTGCCTGG - Intergenic
1094355474 12:29573430-29573452 TCAGTACCACACACTGTGCCAGG + Intronic
1095374056 12:41505235-41505257 TCAGTGCCTCACCAACAGGCGGG + Intronic
1096511373 12:52131462-52131484 TCAGTGCCTCGCAAAGTGTCTGG - Intergenic
1097323358 12:58248979-58249001 TCAGTGCCTAGCGAAGTGCCCGG + Intergenic
1097348322 12:58519767-58519789 TAAGTGCCAAACAGAGTGCCTGG + Intergenic
1098394493 12:70003900-70003922 CCAGTGCCTAGCCAAGTGCCTGG - Intergenic
1099807886 12:87543167-87543189 GCAGTGCAACTGCAAGTGCCAGG + Intergenic
1100302491 12:93321005-93321027 TCAGTGCAACCTCAAATGCCTGG + Intergenic
1101050609 12:100859770-100859792 TAAATGCCACACCTAGTGCCAGG - Intronic
1102097585 12:110252706-110252728 TCAGAGCCTCAACAAGTGCCAGG - Intergenic
1102617371 12:114166334-114166356 GCAGTGCCACATCAAGGGCAAGG - Intergenic
1102938978 12:116921613-116921635 TCAGGGCCACACCAGGTGCTAGG - Intronic
1106818529 13:33437114-33437136 CCAGTGCCACACCCTGGGCCTGG + Intergenic
1110770976 13:79345732-79345754 TCAGTGCTACAAACAGTGCCAGG + Intronic
1111978050 13:94988086-94988108 TCAGGCCCACACCAAGTCCAGGG + Intergenic
1112790904 13:103001376-103001398 TCAGTGTCCCACACAGTGCCAGG - Intergenic
1112923433 13:104643660-104643682 ACATTTCCACACCAAGGGCCAGG - Intergenic
1114707778 14:24744708-24744730 TCAGTGGGGCACCACGTGCCAGG + Intergenic
1115845191 14:37523675-37523697 TCAGTGCCTAACACAGTGCCTGG - Intronic
1118446957 14:65860832-65860854 TCAGTGGCACTTCAAGAGCCTGG - Intergenic
1119474080 14:74917199-74917221 TCAGTGTCACAGCATGTGCCAGG + Intronic
1120396062 14:83968624-83968646 TCAGTGCGTAACAAAGTGCCTGG + Intergenic
1126138034 15:45411430-45411452 TCAGTGCCCCACCAAGTAGCTGG + Intronic
1126256646 15:46634967-46634989 TCAGGGTCACACAAAGTTCCAGG + Intergenic
1126485489 15:49175753-49175775 CCAGTGCCACACCCTGGGCCTGG + Intronic
1127921554 15:63498456-63498478 TCTGTGCCCTACCACGTGCCAGG - Intergenic
1128510608 15:68311855-68311877 GCAGTGCCACATTCAGTGCCAGG + Intronic
1128781279 15:70360240-70360262 TCAGTGACACACAAAGTTCAGGG + Intergenic
1128833880 15:70793863-70793885 ACAGTGCCACACCAGCTGGCTGG - Intergenic
1128869971 15:71147277-71147299 TCACTGCCACCTCAAATGCCTGG + Intronic
1131516108 15:93077956-93077978 TCTCTGCCGCACAAAGTGCCGGG + Intronic
1133965714 16:10530256-10530278 TCAGAGCCTCACACAGTGCCTGG + Exonic
1137977639 16:53044552-53044574 TCAGGGCCACATTAAGTTCCTGG + Intergenic
1138266272 16:55662042-55662064 TGAGTGCCACACCAGCTGGCTGG - Intronic
1140780755 16:78294267-78294289 TCTGTGCCAAGCCCAGTGCCGGG + Intronic
1141496380 16:84413255-84413277 TCAGTTGCACAACATGTGCCTGG - Intronic
1142164614 16:88579526-88579548 TCAGTGCCGCACCATGGGCGCGG + Intronic
1142312832 16:89323796-89323818 TCAGGGCCACACCAACTGTGGGG + Intronic
1142666076 17:1464573-1464595 TCACTGCCACTCCCAGAGCCAGG - Exonic
1144038734 17:11389753-11389775 TCAGTGCCAAGACCAGTGCCAGG - Intronic
1144208496 17:12995722-12995744 GCAGTACCACAACCAGTGCCAGG - Exonic
1144469543 17:15525229-15525251 TCAGTGCATGACCCAGTGCCGGG - Intronic
1144926812 17:18818446-18818468 TCAGTGCATGACCCAGTGCCGGG + Intergenic
1145116266 17:20213343-20213365 TCAGTGCCTCCCAAAGTGCTGGG + Intronic
1146009462 17:29181572-29181594 TCTGTGTCACCCCAAGTGCCTGG - Intergenic
1146815113 17:35936263-35936285 TCAGTCCCAGTCCAAGTTCCTGG - Intronic
1147564826 17:41529654-41529676 GCAGAGCGACACAAAGTGCCCGG + Intergenic
1149018493 17:51936132-51936154 TCAGTGCCAACCCTAATGCCTGG - Intronic
1149453790 17:56770860-56770882 CCAGTGCCTCACATAGTGCCTGG - Intergenic
1149535747 17:57432152-57432174 CCAGAGCCACATTAAGTGCCTGG - Intronic
1150433099 17:65134367-65134389 TCAGTGCCTTACCAAGGGCAAGG - Intergenic
1152234015 17:79129190-79129212 TCAGTGCTTCACCCAGTGCTGGG - Intronic
1155361968 18:25012031-25012053 GCAGTGCCACTGCAAGTCCCAGG + Intergenic
1158547923 18:58411554-58411576 TCAGTCCCACACCAAGAAGCAGG - Intergenic
1160120473 18:76126276-76126298 TGTGTGCCACACCATGGGCCAGG - Intergenic
1161216364 19:3096848-3096870 TCAGTGCCACGCAGAGAGCCGGG + Intronic
1161313129 19:3606194-3606216 TCCCTGCCACACCCAGGGCCTGG + Intronic
1162918767 19:13888395-13888417 TCACTGCCACACCCAGTGTGTGG + Intronic
1163091453 19:15022885-15022907 GCAGTGCCACATCACGTACCTGG + Exonic
1163867470 19:19786131-19786153 CCAGCGCCACACCATGGGCCTGG - Exonic
1163991434 19:21002487-21002509 CCAGTGCCACACCCTGAGCCTGG + Intergenic
1164264329 19:23598688-23598710 TCGGTGCCACACCCTGGGCCTGG - Intronic
1166230012 19:41421229-41421251 CCGGTGCCACTCCAAGTGCAGGG + Intronic
1167194683 19:48019964-48019986 TCAGTGCCCAACTCAGTGCCTGG - Intronic
1167703113 19:51062576-51062598 TCAATGCCAGACACAGTGCCTGG - Intronic
1168093554 19:54101514-54101536 ACAGTATCACACCAAGAGCCTGG - Intronic
926350300 2:11987889-11987911 TGAGTGCCAAACCCTGTGCCAGG + Intergenic
927876529 2:26659005-26659027 TCAGTGGGACACCAACTCCCAGG + Intergenic
928662129 2:33513458-33513480 TCAATGCCTAACCAAGTTCCTGG + Intronic
930205574 2:48584086-48584108 CAAGTGCCACATCAAGTGCTGGG + Intronic
931439007 2:62274108-62274130 TCAGTCCCACAAGAAGTCCCAGG - Intergenic
931488235 2:62715545-62715567 ACATGGCCACACCAAGTGCAAGG - Intronic
932331038 2:70898595-70898617 TCACTGCCACTCCCAGGGCCTGG + Intergenic
934516710 2:94992907-94992929 TCAGTGCCACCCAAGGTGTCAGG - Intergenic
936572279 2:113627077-113627099 TCAGTACCACACCCACAGCCAGG + Intergenic
938917942 2:135963038-135963060 TCAGTGCTACACAAAGACCCTGG + Intronic
939343811 2:140936087-140936109 TCACTGCCTCTCAAAGTGCCAGG - Intronic
943613577 2:190065279-190065301 TCAGTGCCTCACCCAGTCCCTGG - Intronic
945497342 2:210525139-210525161 TCTGTGCCACACCAAGGACAAGG + Intronic
945605871 2:211929743-211929765 TCAGTGACACACAATGTGCATGG + Intronic
945724081 2:213453697-213453719 TCAGTGCCACACTCACTGCCTGG - Intronic
946774436 2:223123249-223123271 TCCGTGCCTAACAAAGTGCCTGG - Intronic
947375883 2:229494539-229494561 ACACTGCCACACCAGGGGCCTGG - Intronic
948228585 2:236333131-236333153 TCAAGTCCCCACCAAGTGCCGGG - Intronic
948577280 2:238963007-238963029 TCATTGGAACACCCAGTGCCAGG - Intergenic
1169939506 20:10921481-10921503 TGAGTGCTACACCAGGTGCTGGG - Intergenic
1172560421 20:35883138-35883160 TCACTGCAACACCGAATGCCTGG - Intronic
1173014380 20:39211551-39211573 TCAAGGCCACACCAAGTCCTGGG - Intergenic
1173569808 20:44068797-44068819 GCAGTGACACACCCATTGCCCGG + Exonic
1173626506 20:44476540-44476562 CCACTGCCACCCCCAGTGCCGGG - Intronic
1173705271 20:45105711-45105733 TCACTGGCACTCCAAGAGCCTGG + Intergenic
1176942467 21:14940534-14940556 TCAGTGCCACAGTAACAGCCAGG + Intergenic
1176989991 21:15484018-15484040 TCAGTGCCAAAACAAGTACCAGG + Intergenic
1177519332 21:22197629-22197651 TCAGTGCCACACCCTGGGCCTGG + Intergenic
1178809953 21:35872465-35872487 TCACTGCCAAGCCCAGTGCCTGG + Intronic
1178991291 21:37358724-37358746 TCAGTGCTTCGCCCAGTGCCTGG - Intergenic
1180057797 21:45367861-45367883 TCAAGGCCACACCAAGTGTCAGG - Intergenic
1182084202 22:27550388-27550410 TCAGAGACACACGAATTGCCTGG - Intergenic
1183233166 22:36595805-36595827 GCAGTGCCCCACCAACCGCCAGG + Intronic
1184381052 22:44145179-44145201 TTAGTTCCACACCAAGAGCGAGG + Intronic
1184695443 22:46136529-46136551 CCAGCTCCACACCAAGTACCTGG - Intergenic
1184835845 22:47020517-47020539 ACAGTGCCACACCAACAGGCAGG - Intronic
1185419454 22:50727415-50727437 TCATTGCCACACACAGAGCCTGG - Intergenic
950636280 3:14317405-14317427 TCAGTGCCAGAATAAGTCCCAGG + Intergenic
952768353 3:36974969-36974991 TCAGTGCCCAAACCAGTGCCTGG - Intergenic
953660114 3:44885686-44885708 TCAGAGCCTCACTATGTGCCAGG - Intronic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
957277146 3:78105090-78105112 TCAGTGACATACCAAGGGCGGGG - Intergenic
957654335 3:83053934-83053956 TGTGTGACACTCCAAGTGCCAGG + Intergenic
962096127 3:132295078-132295100 CCAGTGCCACACCCTGGGCCTGG + Intergenic
962259411 3:133893623-133893645 TTAGTGCCTCTCAAAGTGCCTGG - Intronic
964824665 3:160811947-160811969 TCAGTGCCACACCAAGTGCCTGG - Intronic
965670546 3:171143336-171143358 TCAATGCAAGACCAAGTCCCTGG + Intronic
966602907 3:181793470-181793492 ACAGTGCCCCAAAAAGTGCCTGG + Intergenic
968391726 4:198391-198413 TCAGGTCCAGACCCAGTGCCTGG + Intergenic
968405270 4:335529-335551 TCAGGTCCAGACCCAGTGCCTGG + Intergenic
969924762 4:10575499-10575521 TCACTGCCATACCAGGTGCCAGG - Intronic
972790495 4:42367107-42367129 TCAGAGCTAGACAAAGTGCCAGG - Intergenic
974319003 4:60319782-60319804 TCAGAGCCAGAAAAAGTGCCAGG + Intergenic
977708199 4:100094773-100094795 ACAGTGCCCAACCCAGTGCCTGG + Intergenic
978534646 4:109748300-109748322 TCAGTGCCTAACACAGTGCCTGG - Intronic
984882757 4:184424994-184425016 TCAGGGCCAGGCCTAGTGCCTGG - Intronic
985414028 4:189718719-189718741 CCAGTGCCACACCCTGGGCCTGG + Intergenic
985776563 5:1847264-1847286 TCACTCCCACACCCAGTGCGTGG - Intergenic
987864775 5:23524934-23524956 TCAGTGCCAGACCATGTTGCAGG + Intronic
989799008 5:45512657-45512679 TCAGTGCCACACCATGACCTGGG - Intronic
990716674 5:58645218-58645240 TCAGTGCGTCAGCAAGTGCCAGG + Intronic
995361220 5:111299458-111299480 TGTGTGTCACACCAAGTGCCAGG - Intronic
995603534 5:113825509-113825531 TCAGAACCACACCTAGTGCCTGG - Intergenic
998165151 5:139838534-139838556 TCAGTGCCAGGCCCAGTGCTGGG + Intronic
1001835308 5:174826324-174826346 TCAGTGCCTCTTCCAGTGCCTGG - Intergenic
1002461942 5:179378274-179378296 TCAGTGCCCAGCCCAGTGCCTGG + Intergenic
1003043301 6:2709501-2709523 TCAGGGCCACAGCAAGCCCCAGG + Intronic
1003169537 6:3710243-3710265 TCAGTGTCACAATAAATGCCTGG - Intergenic
1003760504 6:9173784-9173806 TAAGTGTCACACCAAGTGTCAGG - Intergenic
1003884955 6:10513138-10513160 TCACTGCCACATCAACTTCCTGG - Intronic
1005084579 6:21991931-21991953 CAAGTGCCACACACAGTGCCTGG + Intergenic
1006454199 6:34122687-34122709 TCAGTTCCACACCAAGGCCCCGG + Intronic
1006748573 6:36362554-36362576 TCAATGCCTCACCTGGTGCCCGG + Intronic
1008912980 6:56756466-56756488 TCAGTGGCCCACAAGGTGCCAGG + Intronic
1010042498 6:71402280-71402302 TCAGTTCCAGACCCAGGGCCTGG + Intergenic
1013349157 6:109290431-109290453 CCACTGCCACACCGACTGCCTGG - Intergenic
1014547449 6:122749138-122749160 CCAGTGCCACACCCTGGGCCTGG - Intergenic
1019973747 7:4563441-4563463 ACAGTGCCCCACCCAGTGACTGG + Intergenic
1021709364 7:23399997-23400019 TCAATGCCACACCAGGTCCTTGG + Intronic
1022028601 7:26470907-26470929 TCCTTGCCACTCCAAGTGCTGGG + Intergenic
1024750159 7:52455714-52455736 TCAGGATCACACCAAGTGGCAGG + Intergenic
1025923687 7:65938948-65938970 TCAGGGCCACACCAGGTGGTTGG + Intronic
1027173127 7:75886865-75886887 ACACTGCCACACCCAGTGCCAGG + Intronic
1028857558 7:95608849-95608871 TCAGTCCCACACCCACAGCCTGG + Intergenic
1029694564 7:102204376-102204398 TCGGTGCCACTCCAGGTGCTGGG + Exonic
1030628484 7:111869939-111869961 ACTGTGCCCAACCAAGTGCCTGG + Intronic
1032178792 7:129657202-129657224 ACCGTGCCACACCAAGTCACAGG - Intronic
1034034950 7:147809342-147809364 TCAGTGCCAGACACAGTGCTGGG + Intronic
1035271577 7:157722912-157722934 TCAGTGACCTACCAGGTGCCAGG - Intronic
1037686533 8:21144361-21144383 TCAGTGCCTAACCCAGTGCTTGG - Intergenic
1040822380 8:51577028-51577050 TCAGTGACACAACATGAGCCTGG - Intronic
1043394193 8:79820957-79820979 TCAGTACCAAGCCCAGTGCCTGG - Intergenic
1044707251 8:95020699-95020721 CCAGTGCCTGGCCAAGTGCCTGG - Intronic
1045351335 8:101343044-101343066 TAAGTGCCTCACACAGTGCCTGG - Intergenic
1045490041 8:102661241-102661263 TCATTGCCCCACCATATGCCAGG + Intergenic
1045747285 8:105438347-105438369 TCAGTGCCCAACACAGTGCCTGG + Intronic
1048302152 8:133259733-133259755 CCATTGCCTCACCAAGAGCCCGG - Intronic
1048325732 8:133437424-133437446 TCAGTGCCTGACACAGTGCCTGG - Intergenic
1048795210 8:138143364-138143386 CGACTGCCACACCACGTGCCTGG + Intronic
1056059105 9:82864263-82864285 TCAGTGCCACACCTGGTCTCCGG + Intergenic
1056462410 9:86820803-86820825 ACAGGCCCACACAAAGTGCCAGG - Intergenic
1057534535 9:95886633-95886655 TCAGTGCCAATCACAGTGCCTGG - Intronic
1059080596 9:111245058-111245080 TCAGTGCAACACTATTTGCCTGG + Intergenic
1059999799 9:119947990-119948012 TCAATTCCACACCATCTGCCTGG - Intergenic
1061051886 9:128201625-128201647 TCAGTGCCACACAACTTGCATGG - Intronic
1061442379 9:130614687-130614709 TCAGTAGCTCACCAAGTGACTGG - Intronic
1190137254 X:47808082-47808104 TCTGTGCGACACCTGGTGCCAGG - Intergenic
1192743782 X:73918658-73918680 CCAGTGCCACACCCTGGGCCTGG - Intergenic
1192950382 X:76010075-76010097 TCAGTCCCACTGCAAGTACCTGG + Intergenic
1197622811 X:128770067-128770089 TCAATGCCACAGGAAGTGCATGG + Intergenic
1198245380 X:134826206-134826228 TGAGTGGCACACCAAGTTCGTGG - Intronic
1201223181 Y:11790931-11790953 TCAGCGCCACACCCTGGGCCTGG - Intergenic
1201749230 Y:17414151-17414173 TCACTGCCATACCAGGTCCCTGG - Intergenic