ID: 964826909

View in Genome Browser
Species Human (GRCh38)
Location 3:160838723-160838745
Sequence TTCCATCTCCTTACTAGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 3, 3: 18, 4: 253}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
964826909_964826911 8 Left 964826909 3:160838723-160838745 CCATCTCTAGTAAGGAGATGGAA 0: 1
1: 0
2: 3
3: 18
4: 253
Right 964826911 3:160838754-160838776 AGAGTTGCCAGTGGATACTGAGG 0: 1
1: 0
2: 1
3: 14
4: 159
964826909_964826910 -1 Left 964826909 3:160838723-160838745 CCATCTCTAGTAAGGAGATGGAA 0: 1
1: 0
2: 3
3: 18
4: 253
Right 964826910 3:160838745-160838767 ATTAGAGTAAGAGTTGCCAGTGG 0: 1
1: 0
2: 3
3: 28
4: 378
964826909_964826913 24 Left 964826909 3:160838723-160838745 CCATCTCTAGTAAGGAGATGGAA 0: 1
1: 0
2: 3
3: 18
4: 253
Right 964826913 3:160838770-160838792 ACTGAGGATTATGATACAGAAGG 0: 1
1: 0
2: 1
3: 13
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
964826909 Original CRISPR TTCCATCTCCTTACTAGAGA TGG (reversed) Intronic
900252044 1:1675990-1676012 GTCCCTCTCGTTACTAGAGCGGG - Intronic
900262455 1:1738848-1738870 GTCCCTCTCGTTACTAGAGCGGG - Intronic
904458106 1:30659189-30659211 TTCCTCCTCCTCACTGGAGATGG - Intergenic
905063213 1:35157415-35157437 CTCCATCTCCTGACTAGAGACGG + Intergenic
905785561 1:40754303-40754325 TGTCACCTCCTTACTAGAGTAGG + Intronic
907943303 1:59109449-59109471 TTCCATCTCATCACTGAAGATGG - Intergenic
910389870 1:86730366-86730388 TTACAGTTCCTTACTATAGAAGG + Intronic
911677029 1:100670172-100670194 TTTCATGTCCTTGCTAAAGATGG + Intergenic
912518833 1:110231870-110231892 CTCCATCACCTTTCTAGGGAAGG - Intronic
914682074 1:149945360-149945382 TACTATCTCCTTATTACAGAAGG - Intronic
914854471 1:151341180-151341202 TTCTACCTCCATATTAGAGATGG - Exonic
915195934 1:154189621-154189643 TTTCATATTTTTACTAGAGACGG - Intronic
915832425 1:159143311-159143333 TTCCATCTACGACCTAGAGATGG + Intronic
917513644 1:175689019-175689041 TGCCATCTCCTCACTAGACTGGG - Intronic
917567339 1:176226334-176226356 TTTCATGTCTTTAGTAGAGATGG + Intergenic
918602842 1:186383865-186383887 TTTCATATTTTTACTAGAGACGG - Intronic
919272162 1:195361242-195361264 TTCCCTCTCCTTTCTAAAGGTGG - Intergenic
920975864 1:210784761-210784783 TACCATCTCTATATTAGAGATGG + Intronic
921549532 1:216517645-216517667 TTTCATCTCATTATGAGAGATGG + Intronic
921632715 1:217454801-217454823 TTTCATATTTTTACTAGAGACGG + Intronic
921664097 1:217845910-217845932 TTCCATGTGCTTATTAAAGATGG + Intronic
922015574 1:221642893-221642915 TTTCATATTTTTACTAGAGACGG - Intergenic
922186178 1:223276757-223276779 TTCCATCTCCTAAGAAGGGAAGG - Intronic
922999229 1:229992422-229992444 TTTTATCTCCGTCCTAGAGAAGG + Intergenic
923620141 1:235572368-235572390 TTTCATATTCTTAGTAGAGACGG + Intronic
924063891 1:240204764-240204786 TTACATTTCCTTCATAGAGATGG + Intronic
1063809394 10:9686663-9686685 TTCCTTCTCCTTACAAGAAAAGG + Intergenic
1064411984 10:15113296-15113318 TTTCATATCTTTAGTAGAGATGG - Intronic
1064914793 10:20444844-20444866 TTTCATATCTTTATTAGAGATGG - Intergenic
1065615669 10:27520152-27520174 TTCAATCTTCTTACTAGTTATGG + Intronic
1069868098 10:71516474-71516496 CTGTACCTCCTTACTAGAGATGG + Intronic
1073014808 10:100389733-100389755 TTCCATATTTTTAGTAGAGATGG - Intergenic
1074340787 10:112627254-112627276 TTCAATCTCCTTACTTTAGGTGG - Intronic
1074607141 10:114984195-114984217 TTCCATCTCATTTCCTGAGATGG + Intergenic
1074944572 10:118269103-118269125 CTACATTTCCTTAGTAGAGAAGG - Intergenic
1076663083 10:132068378-132068400 TTCAATCCCCGTACTAAAGAGGG - Intergenic
1077232239 11:1463019-1463041 TTCCCACTCCTTACTTGGGAAGG + Intergenic
1077911457 11:6575262-6575284 TGCCATCTCCTTCCAACAGAAGG + Intronic
1078193603 11:9115253-9115275 TGGCATCTCCTTCCAAGAGAAGG + Intronic
1078924087 11:15858594-15858616 GTCCATCCCCTTACAATAGATGG + Intergenic
1079197561 11:18343542-18343564 TTCCATTGCTTTACTAGATATGG + Intronic
1080671090 11:34378812-34378834 TTTCATATTTTTACTAGAGATGG + Intergenic
1082177286 11:49075408-49075430 TTCCATATTTTTAGTAGAGATGG + Intergenic
1082726460 11:56742956-56742978 TTCCACCTACTCCCTAGAGAGGG - Exonic
1084346234 11:68551409-68551431 CACCATCTCCTTTCTAGAGCCGG + Intronic
1085389998 11:76177435-76177457 TCCCCTCTCCCTACCAGAGAGGG - Intergenic
1086595227 11:88562773-88562795 TTCCATTTCCATGATAGAGATGG + Intronic
1086688429 11:89760429-89760451 TTCCATATTTTTAGTAGAGATGG - Intergenic
1086717431 11:90079516-90079538 TTCCATATTTTTAGTAGAGATGG + Intergenic
1086834784 11:91607471-91607493 TTTCATCTTCTTAGTAGAGATGG + Intergenic
1087646243 11:100811668-100811690 TTCCATATTTTTAATAGAGATGG + Intronic
1092116097 12:6008019-6008041 TTTCATCTCCTTACTAATGATGG - Intronic
1092457230 12:8654773-8654795 TTCCGTATTTTTACTAGAGATGG - Intronic
1092684729 12:11029678-11029700 TTTCATCCCTTTATTAGAGAAGG + Intronic
1092689410 12:11090555-11090577 TTTCATCCCTTTATTAGAGAAGG + Intronic
1093591271 12:20904942-20904964 TTTCATGTCTTTAGTAGAGATGG + Intronic
1093816311 12:23552614-23552636 TTCTATCTCCTGACTACATATGG - Intronic
1094060175 12:26306368-26306390 TTCAATCTCCTTATTAGTTATGG - Intergenic
1094343318 12:29437648-29437670 GGCCATCTCTTTACTAAAGAGGG - Intronic
1094630485 12:32169020-32169042 TCCCATCTCCTCACAACAGATGG - Intronic
1095438211 12:42214831-42214853 TTCCATATTTTTAGTAGAGAAGG - Intronic
1095578310 12:43764856-43764878 TAACATCTGCTTATTAGAGAGGG - Intronic
1096303338 12:50451525-50451547 TTTCATATTTTTACTAGAGATGG - Intronic
1098191324 12:67952079-67952101 TTTCATATCTTTAGTAGAGACGG - Intergenic
1098706789 12:73702007-73702029 TTCCCCCTCCCTCCTAGAGAAGG - Intergenic
1100859398 12:98788234-98788256 TTTCTTCTCTTTTCTAGAGATGG - Intronic
1102667384 12:114586870-114586892 TTTCATCTTTTTAGTAGAGACGG - Intergenic
1106777436 13:33021710-33021732 TTCCATATTTTTAGTAGAGACGG - Intronic
1107000865 13:35543704-35543726 TCCCATCTCCTTTTTGGAGATGG + Intronic
1107242451 13:38252757-38252779 TTCCATCTTCATACTACAAATGG + Intergenic
1107713779 13:43178360-43178382 TTCCATCTTCATAACAGAGAAGG + Intergenic
1107743583 13:43480824-43480846 CTCAATCTCCTTACTAGTTATGG - Intronic
1112005346 13:95248865-95248887 TTATATTTTCTTACTAGAGATGG - Intronic
1114304960 14:21414372-21414394 TACTATCTCCCAACTAGAGAAGG - Exonic
1114747039 14:25160270-25160292 TTCCATGTCTTTACTTGGGATGG + Intergenic
1114818527 14:25988281-25988303 TTTCATCTCCTTGTTAGAAATGG - Intergenic
1115019574 14:28659843-28659865 TTCGACCTCCTTACTAGGTAGGG + Intergenic
1116388678 14:44364732-44364754 TTCACTCTCCCTACCAGAGAGGG - Intergenic
1124464284 15:29922015-29922037 TTCCATGTTTTTAGTAGAGACGG + Intronic
1127411121 15:58707904-58707926 TTCCATATTTTTAGTAGAGATGG - Intronic
1130126361 15:81097276-81097298 TTCCTTTTCTTTTCTAGAGATGG + Intronic
1130530861 15:84747554-84747576 TTGCATCTCCTTCCTGGAGAAGG + Intergenic
1130711647 15:86288276-86288298 TTCCAGCTCCTTAGTTAAGAAGG - Intronic
1132021347 15:98365335-98365357 TTCCATATTTTTAGTAGAGATGG - Intergenic
1134093952 16:11406600-11406622 TTCCATATTTTTAGTAGAGACGG + Intronic
1134605639 16:15569043-15569065 TTTCATATTTTTACTAGAGATGG - Intronic
1136558150 16:31021105-31021127 TTCCATTTTTTTAGTAGAGATGG + Intergenic
1137577540 16:49611963-49611985 TTCCATTTCCTTAATAGAATAGG - Intronic
1137929774 16:52575952-52575974 TTCCATGTCCTTTCTAGCAAAGG - Intergenic
1138682372 16:58694757-58694779 TTCCATATTTTTAGTAGAGACGG + Intergenic
1138866123 16:60822490-60822512 CTCCATCTCTTTACAAGAAAAGG - Intergenic
1138886271 16:61082936-61082958 CTACATCTCCTTCCTAAAGAAGG + Intergenic
1139240540 16:65387561-65387583 TTCCTTTTCTTTGCTAGAGATGG + Intergenic
1140347788 16:74231226-74231248 TTCTATCTCCTTCCAATAGAAGG + Intergenic
1143171037 17:4930510-4930532 TTTCATATCTTTAGTAGAGACGG - Intergenic
1143613127 17:8031809-8031831 TTTCATATTCTTAGTAGAGACGG - Intergenic
1143659678 17:8316791-8316813 CTCCATCTCCTTCTTCGAGACGG + Intronic
1143820466 17:9557395-9557417 TTCCACCTCTTTTCTAGAGTGGG - Intronic
1147915637 17:43883598-43883620 TTCCATCCCCTTGCCACAGAGGG + Intronic
1149958343 17:61078666-61078688 TTCCCTGTCATTACTTGAGATGG + Intronic
1150453930 17:65292141-65292163 TTTCATATTTTTACTAGAGACGG + Intergenic
1151926901 17:77204388-77204410 TTTCATATTTTTACTAGAGACGG + Intronic
1155730776 18:29155180-29155202 TTTCATCTTCTTACCAAAGAGGG + Intergenic
1156692686 18:39727497-39727519 ATCCATACCCTAACTAGAGAAGG + Intergenic
1157233990 18:45945946-45945968 TTTCATCTCCTTTTAAGAGAGGG + Intronic
1157813473 18:50714744-50714766 CTCCATCTTCTTACTAGACAAGG + Intronic
1158074106 18:53508734-53508756 TTTCATCACCTTATGAGAGACGG + Intronic
1158472185 18:57746988-57747010 TTCCATCTCCCTCCTAAGGATGG + Intronic
1159764727 18:72474453-72474475 TCCCATCTCCTCAGTAGAGATGG + Intergenic
1161813969 19:6487794-6487816 TTCCATATTTTTAGTAGAGATGG - Intergenic
1164188159 19:22890573-22890595 TTCCATCCATTTCCTAGAGATGG + Intergenic
1164308489 19:24025971-24025993 TTTCATATTTTTACTAGAGACGG - Intergenic
1165225155 19:34349512-34349534 CTCCATCTCTTTATTAAAGATGG + Intronic
1166595024 19:44039389-44039411 TTCAATCTCCTTACTAGTTAAGG - Intergenic
925301697 2:2819951-2819973 TTCAATCTCCATACTAGTTATGG - Intergenic
925342084 2:3144912-3144934 TTCCATCTTCTTACAAGTTAGGG - Intergenic
925626510 2:5846733-5846755 TTCCTTCTCATTGCTAGAGATGG - Intergenic
926292358 2:11541173-11541195 TTCCATCTCCTTCTGGGAGATGG - Intronic
927583308 2:24275003-24275025 TTACTTCTCCTTACTATAAATGG + Intronic
928550500 2:32366053-32366075 TTTCGTCTTTTTACTAGAGATGG + Intronic
928713519 2:34034254-34034276 TTCTTTCTCTTTACTTGAGATGG + Intergenic
928824817 2:35406984-35407006 TTTCATCTTTTTAGTAGAGATGG + Intergenic
929831380 2:45349485-45349507 TTCCCACTGCCTACTAGAGAGGG - Intergenic
930960840 2:57259709-57259731 TTTCATCTTCTTAGTAGAGAGGG - Intergenic
931215909 2:60244459-60244481 TTCCATGTCATTACTAGAGTGGG - Intergenic
932506391 2:72236141-72236163 GTTCCTCTCCTTACTAGAGCAGG + Intronic
934844242 2:97652013-97652035 TACCATCCCCATAATAGAGATGG + Intergenic
935843168 2:107136102-107136124 TTCAATCTCCTTTCTAGTAACGG + Intergenic
936344846 2:111667655-111667677 TTCCTTTTCCTTCCTAGATAGGG - Intergenic
936851686 2:116906909-116906931 TTTCATATTCTTATTAGAGAAGG + Intergenic
938975164 2:136469800-136469822 TTCCAGCTCCTTGCTAGCAACGG + Intergenic
939654449 2:144806057-144806079 CTCCATCTCCTTGCCAAAGAGGG - Intergenic
940582239 2:155597229-155597251 TTGCATTTTTTTACTAGAGATGG + Intergenic
941159005 2:162014206-162014228 TCACATCTTCTTAATAGAGAAGG - Intronic
941418575 2:165253250-165253272 TTCTATCTCCTTTCTAGAGCTGG + Intronic
942208790 2:173650070-173650092 GTCCATGTCCTTCCTAGAAAAGG - Intergenic
942849263 2:180464015-180464037 ATCCATATACTTAATAGAGAAGG - Intergenic
942994043 2:182238838-182238860 TTCCATTTCCATTCAAGAGAAGG - Intronic
943360594 2:186914329-186914351 TTTCATATCTTTAGTAGAGAAGG - Intergenic
943585516 2:189734791-189734813 TTTTATCTCTTTAGTAGAGATGG - Intronic
946295289 2:218779044-218779066 TTCCATGCCCTAACTAGACATGG - Intergenic
946522503 2:220481982-220482004 TTTCATATTCTTAGTAGAGATGG + Intergenic
946570391 2:221018113-221018135 TTCATTCTCCTCACTAGGGAGGG + Intergenic
948736167 2:240007044-240007066 TTCCATCTCTTTAATAAAAATGG + Intronic
1170465111 20:16615710-16615732 TTCCATCTACTTTCCAAAGATGG + Intergenic
1171270784 20:23815248-23815270 TTCCATACCCTTATTAGGGAGGG + Intergenic
1172144375 20:32745822-32745844 TTTTGTCTTCTTACTAGAGATGG + Intergenic
1172836506 20:37876910-37876932 TTCCAGCTGGTTGCTAGAGAGGG + Intergenic
1175536276 20:59716421-59716443 TTTCATATTTTTACTAGAGACGG + Intronic
1176038914 20:63054243-63054265 TTCCATCTCCGTTCTGGAGCTGG + Intergenic
1179620434 21:42611715-42611737 TTTCATATTTTTACTAGAGATGG - Intergenic
1179928612 21:44552030-44552052 TTCCATCTCCTTCTCAGAGGAGG - Intronic
1182449419 22:30410025-30410047 TTCCATATTTTTAGTAGAGATGG - Intronic
952326925 3:32328807-32328829 TTCCATCTTTTTACTAGTTATGG - Intronic
952940797 3:38443006-38443028 TCCCATATCCTTATTAGGGAGGG - Intergenic
953274140 3:41478160-41478182 GTCCTTCCCCTGACTAGAGAAGG - Intronic
953648380 3:44776131-44776153 TTCAGTCTCCTTATTTGAGACGG - Intronic
954024207 3:47769397-47769419 TCCCAGCTACTTAGTAGAGACGG + Intronic
955202488 3:56863468-56863490 TTTCATATTTTTACTAGAGATGG + Intronic
955217854 3:56999220-56999242 TTTTATCTTCTTAGTAGAGATGG + Intronic
956151774 3:66251184-66251206 TCCCAACTCCTTACTATAGCAGG - Intronic
956966730 3:74470473-74470495 TTCTATCTCTTTCCCAGAGAAGG - Intronic
959001628 3:100970771-100970793 CTCCCTCTCCTTACAAGTGAGGG + Intronic
960245703 3:115398255-115398277 TACCATCTCTTTAAAAGAGATGG + Intergenic
960631916 3:119741020-119741042 TTCCGTATTCTTAGTAGAGATGG + Intronic
961835690 3:129657014-129657036 TTCTCTCTCTTTACCAGAGAGGG + Intronic
961914135 3:130352680-130352702 GTGCATCTCCTTAGTGGAGAGGG + Intronic
963065672 3:141261806-141261828 TTCCATCTGCTTTTTAGAGCAGG - Intronic
963767874 3:149356501-149356523 TTCCATCCCCCAACCAGAGATGG - Intergenic
964091459 3:152881153-152881175 TTCCATTTATTTACTAGAAAAGG - Intergenic
964826909 3:160838723-160838745 TTCCATCTCCTTACTAGAGATGG - Intronic
966906208 3:184527678-184527700 TTTCATATCTTTAGTAGAGATGG + Intronic
966996396 3:185284543-185284565 TTCCATATTTTTAGTAGAGATGG - Intronic
971110094 4:23575340-23575362 TTGCATTTTCTTAGTAGAGACGG - Intergenic
971237100 4:24852378-24852400 TTCCAACTCCTTGCCAGAGGTGG - Intronic
971497245 4:27280069-27280091 TTCCATCTCCCTACTATACCTGG + Intergenic
972580509 4:40391568-40391590 TTCCTTCTCCTTGCTGGAGATGG + Intergenic
972897858 4:43645177-43645199 TTCCATCTCTTAATCAGAGATGG + Intergenic
974819095 4:67043811-67043833 TTGCATCTCCTGACAAGAGCAGG + Intergenic
976864224 4:89704918-89704940 TTCCTCCTCCTCCCTAGAGAAGG + Intergenic
977853627 4:101860599-101860621 TTTCATGTCTTTAGTAGAGATGG + Intronic
978499482 4:109393720-109393742 TGCCATGTCCTTACAAGACATGG + Intergenic
979549896 4:121978887-121978909 TTCCATCTCTTTACTAATAAAGG - Intergenic
979634179 4:122938765-122938787 TTAAATCTTCTTAGTAGAGATGG + Intronic
980274968 4:130638593-130638615 TTTCATATTCTTAGTAGAGATGG + Intergenic
980448707 4:132944087-132944109 TTCCATGTTTTTAGTAGAGACGG + Intergenic
981025263 4:140071325-140071347 ATCCATTTCCTTGCTAAAGAAGG - Intronic
981095262 4:140772833-140772855 TTTCATATTCTTAGTAGAGATGG + Intergenic
981715265 4:147745958-147745980 TTGCATCTTTTTAGTAGAGATGG + Intronic
983154459 4:164329063-164329085 CTACATCTCGTTACTGGAGAAGG + Intronic
983703474 4:170627946-170627968 TTCAATCTCCTTACTTGTTAAGG + Intergenic
983900536 4:173128680-173128702 TACCATCACCTTTCTAGAGGAGG - Intergenic
987442771 5:17977208-17977230 TTCCATCTTCATCCTAAAGAAGG - Intergenic
988391362 5:30637165-30637187 TTCCATCTTCATACTAGTTATGG + Intergenic
988909691 5:35826788-35826810 TTCCATTTCCACTCTAGAGAGGG + Intergenic
993445070 5:88001900-88001922 TGCCATCTCCTTATGAGAGTTGG + Intergenic
993720658 5:91318533-91318555 TTCCATATTGTTAGTAGAGATGG - Intergenic
998760612 5:145428127-145428149 TTTCATATGTTTACTAGAGATGG + Intergenic
1000023713 5:157340871-157340893 TGCCGTCTCCTTTCTATAGATGG - Intronic
1000263227 5:159610138-159610160 TTCCATCTGCTCACTCAAGAAGG + Intergenic
1001389559 5:171367890-171367912 TTCCACATCTTTAGTAGAGACGG + Intergenic
1001421811 5:171593322-171593344 TGCCATCTCCTCACTCTAGAAGG - Intergenic
1002155335 5:177273807-177273829 TTCCATTTCTCTTCTAGAGAAGG - Intronic
1004230074 6:13824713-13824735 TTTCATATCTTTAGTAGAGACGG + Intergenic
1007820073 6:44554628-44554650 TTTCACCTCCTTCCTAGTGATGG - Intergenic
1008622251 6:53282063-53282085 TACCATCTGCTTTCTACAGAGGG - Intronic
1010337243 6:74701389-74701411 TTCCAACTTCTTTCTAGAAAAGG + Intergenic
1010699781 6:79029698-79029720 TTCTGTATCTTTACTAGAGATGG + Intronic
1010719440 6:79265468-79265490 TTCAATCTCCTTACTTGTCATGG - Intergenic
1010723040 6:79305277-79305299 TTGCATGTCATTACTAGAAATGG + Intergenic
1011052448 6:83168052-83168074 TTTCATGTCCTTATTAGGGAAGG - Exonic
1011522395 6:88223074-88223096 TTTCATATCTTTAGTAGAGACGG + Intergenic
1011523707 6:88239749-88239771 TTCCATATTTTTAGTAGAGATGG - Intergenic
1012104147 6:95132011-95132033 TTCAATCTCCTTATTTGGGAGGG - Intergenic
1012533033 6:100261468-100261490 TTCCTTCTTTTAACTAGAGATGG - Intergenic
1014745741 6:125198333-125198355 TTTCAGCTACTTACTAGAGATGG + Intronic
1017986632 6:159448618-159448640 TTCCATCTCCACACTAGGCAGGG - Intergenic
1022066179 7:26860193-26860215 TTTCATCTCATTACTATATAAGG - Intronic
1022386154 7:29901055-29901077 TTCCATCTCCTGTCCACAGATGG - Intronic
1022654551 7:32306775-32306797 TTCCCACTCCTTACAGGAGAAGG - Intergenic
1023244672 7:38188477-38188499 TTCCATCCCCTTCCTGTAGAAGG + Intronic
1023498507 7:40823690-40823712 TTCCTTCTCCTTTTTTGAGAAGG + Intronic
1023862483 7:44224827-44224849 TTCCACCTCCTTTCTCCAGAAGG - Intronic
1024681545 7:51694626-51694648 ATCCATCTGCTTACTTGAGTGGG + Intergenic
1025142963 7:56480649-56480671 TTTTGTATCCTTACTAGAGACGG - Intergenic
1026215451 7:68344337-68344359 TTTCATATTATTACTAGAGACGG - Intergenic
1026251791 7:68677621-68677643 TTCCATATTTTTAGTAGAGATGG - Intergenic
1027387195 7:77670445-77670467 TTGTATTTCTTTACTAGAGATGG - Intergenic
1027791254 7:82640543-82640565 TCCCATACCCTTATTAGAGAGGG + Intergenic
1028489765 7:91398381-91398403 ATTCATCTCCTTACCAAAGAAGG + Intergenic
1029122406 7:98277728-98277750 TTTCATATCTTTAGTAGAGATGG - Intronic
1030309991 7:108059391-108059413 GTCCTTCTCCCAACTAGAGATGG + Intronic
1030717132 7:112822191-112822213 TTCCATCTCCTTACCAGCGATGG - Exonic
1031022492 7:116643282-116643304 TTCCATATTTTTAGTAGAGATGG + Intergenic
1031417860 7:121514831-121514853 TTCCATATCCTCAACAGAGAAGG - Intergenic
1033213967 7:139480912-139480934 TTTCATATCTTTAGTAGAGATGG + Intronic
1033374277 7:140742362-140742384 TTCCATTTTTTTAGTAGAGATGG + Intronic
1033542180 7:142367349-142367371 TTCCATATTTTTAGTAGAGATGG + Intergenic
1034209080 7:149346648-149346670 TTAAATCTCCTTACTAGTCATGG - Intergenic
1037764181 8:21761777-21761799 TTCCATATCTTTAGTAGAGATGG - Intronic
1037799159 8:22023012-22023034 TTTCATATTTTTACTAGAGATGG - Intergenic
1040360992 8:46664367-46664389 TTGCATTTTCTTAGTAGAGACGG - Intergenic
1040375396 8:46819795-46819817 TTCTAGATCCTTCCTAGAGAGGG + Intergenic
1040803869 8:51372553-51372575 TTTTATATCGTTACTAGAGACGG + Intronic
1041225617 8:55694586-55694608 TTCTATATTTTTACTAGAGACGG + Intergenic
1041496413 8:58489971-58489993 TTTCATATCCTTAGTAGAGACGG - Intergenic
1042027755 8:64442229-64442251 TTCCAGATCCTTACTAGAGATGG + Intergenic
1042245050 8:66701441-66701463 TTCTTTCTCTTTAATAGAGACGG + Intronic
1043201388 8:77373761-77373783 TGACTTCTCCTTCCTAGAGAGGG + Intergenic
1049924715 9:397516-397538 TTCCATATTTTTAGTAGAGACGG - Intronic
1050285277 9:4095403-4095425 CTCTATCTACTTACTAGTGAAGG - Intronic
1050623933 9:7483657-7483679 TTTCATATCTTTAATAGAGACGG + Intergenic
1053243894 9:36518851-36518873 TTTCATCTTTTTAGTAGAGACGG + Intergenic
1053490870 9:38500919-38500941 TTGCATTTTCTTAGTAGAGACGG + Intergenic
1055452014 9:76439574-76439596 CTGCATTTCCTTAGTAGAGATGG + Intronic
1055647857 9:78377776-78377798 CTCCATCTGCTTGCTGGAGATGG + Intergenic
1056874332 9:90313323-90313345 TTCTATATTCTTAGTAGAGACGG - Intergenic
1057298417 9:93862448-93862470 TTCCATAACCTTATGAGAGAGGG + Intergenic
1060653929 9:125355274-125355296 TTTCATATCTTTAGTAGAGATGG + Intronic
1061147504 9:128808532-128808554 TTCCACCTCCTTCCCAGAGTGGG + Exonic
1061363005 9:130155599-130155621 TTCCATATTTTTAGTAGAGACGG + Intergenic
1062336337 9:136071370-136071392 TTTCATATCTTTAGTAGAGACGG - Intronic
1062573774 9:137197271-137197293 TTATATCTTCTTAGTAGAGACGG + Intronic
1186881936 X:13875167-13875189 ATCCATCTCCATCCTTGAGATGG + Intronic
1188156338 X:26748002-26748024 TTCCACCTACTTCTTAGAGAAGG + Intergenic
1188607957 X:32056598-32056620 TTCAATCTCCTTACTAGTTTCGG - Intronic
1193912663 X:87324750-87324772 ATTAATCTCCATACTAGAGAAGG + Intergenic
1195965972 X:110430699-110430721 TTTCATTTCCTAACTAGAGAAGG + Intronic
1196829504 X:119765184-119765206 TTTCATATTTTTACTAGAGACGG - Intergenic
1197664948 X:129213583-129213605 TTCCATCTTCTTACTAGCTAAGG - Intergenic
1197691661 X:129507557-129507579 TTCCATCTTTTTTCTTGAGACGG + Intronic
1200405818 Y:2810653-2810675 TTGCAGCTCCTTACCAGTGATGG - Intergenic
1200544727 Y:4505729-4505751 TTCCATATTTTTAGTAGAGATGG + Intergenic
1200573963 Y:4866124-4866146 TTCCAGCTTCTCACTAAAGAAGG + Intergenic
1200849465 Y:7868043-7868065 TTCTATATCCTAACTAGAGAGGG - Intergenic